From harper@csc.fi Fri Mar 33 12:12:12 EST 1909 Newsgroups: bionet.molbio.methds-reagnts Subject: Re: PCR Machines (Batch mail, and an offer you can't refuse) Message-ID: <1991Jun5.134429.1@csc.fi> Date: 5 Jun 91 13:44:29 GMT References: <750@ariel.ucs.unimelb.edu.au> Sender: usenet@nic.funet.fi Lines: 145 Nntp-Posting-Host: csc.fi Status: O In article <750@ariel.ucs.unimelb.edu.au>, vivien@ariel.ucs.unimelb.edu.au (Vivien Bonazzi) writes: > > > I wanted to make a few inquires about PCR machines that are available on the > market at the moment. I'm thinking of buying a machine for our lab. There has been quite alot written about PCR in the METHODS Bboard. The entries go back to 1990. There is about 90 hits using LDBASE and SEARCH PCR IN +METHODS. Here are the results. You can recover the items you want to read about from LISTSERV by sending a small batch file to LISTSERV@IRLEARN.UCD.IE ( I would just like to say that the technique of using LDBASE or MAIL BATCH processing is VERY SIMPLE and fast. I got the results from LDBASE instantaneously and the batch mail was delivered within 15 minutes. The facilities are available use them.) Here is an example of a batch file to get items dealing with PCR/MACHINES Just cut it out and post it to LISTSERV@IRLEARN.UCD.IE Leave the subject line blank and in the main body of the mail include the following: ----------------- 8< cut here 8<---------------- //methods JOB Echo=YES,Reply-via=MAIL Database search DD=Mine //Mine DD * Search pcr in +methods index print 000260 print 000279 print 000266 print 000470 print 000481 print 000485 /* ---------------- 8< cut here 8<----------------- I enclose the index of items so that if you wnat to ADD more PRINT commands to the above batch job you can do so... perhaps there are other things that you might be interested in. ************************* CLIP ********************* > INDEX Item # Date Time Recs Subject ------ ---- ---- ---- ------- 000012 90/01/26 07:53 20 PCR....help 000013 90/01/26 18:02 40 RE: PCR....help 000014 90/01/31 17:13 31 visualizing small pcr fragments 000015 90/02/01 10:54 18 Re: visualizing small pcr fragments 000016 90/02/01 09:33 36 Small PCR fragments. 000018 90/01/29 16:20 39 Re: PCR....help 000019 90/02/03 19:25 18 PCR * Enzymes cut ss-DNA? 000020 90/02/12 17:55 40 Re: visualizing small pcr fragments 000028 90/02/12 18:14 26 Re: visualizing small pcr fragments 000030 90/02/20 21:48 36 UV light kills DNA contamination in PCR samples 000032 90/02/21 11:22 12 Primers for PCR 000034 90/02/23 20:11 39 re: PCR...help 000061 90/04/11 11:25 21 PCR ON YEAST RNA 000064 90/04/19 23:32 29 Computer program for choosing oligonucleotides (qu+ 000065 90/04/29 23:33 23 Looking for cheap Thermal Cyclers 000080 90/05/29 18:12 17 000085 90/05/30 13:55 65 Re: (none) 000099 90/06/19 10:25 17 PCR errors 000102 90/06/25 06:40 32 Re: PCR errors 000123 90/07/11 17:28 46 000124 90/07/11 14:55 21 LONG PCR FRAGMENTS 000134 90/07/21 08:18 16 PCR reagent software 000146 90/07/27 13:37 20 pcr primer dimer help 000151 90/07/31 16:41 33 Bacteria and PCR 000184 90/09/05 00:39 24 Southerns with seiving agarose 000186 90/09/06 14:24 20 melting algorithms 000191 90/09/12 14:39 48 Cloning PCR fragents into vector 000192 90/09/13 10:00 75 Re: Cloning PCR fragents into vector 000193 90/09/14 01:53 70 Re: Returned Network Mail 000197 90/09/18 12:14 25 melting algorithms 000203 90/09/27 02:27 81 Re: Oligo directed Insertions 000206 90/09/28 13:29 51 PCR Sequencing 000208 90/10/01 12:08 17 re:pcr sequencing 000210 90/10/02 09:38 60 RE: PCR sequencing 000213 90/10/02 12:51 25 re:PCR sequencing 000220 90/10/09 12:15 35 DNA ISOLATION 000229 90/10/04 17:16 28 VNTR sequencing 000242 90/10/23 13:53 21 000243 90/10/23 17:59 24 asymmetric PCR + sequencing 000244 90/10/24 19:36 26 RNA to cDNA then PCR 000248 90/10/29 21:30 23 Re: Oligonucleotide probing 000250 90/11/02 06:31 26 PCR Primer Selection Programs Required 000251 90/11/02 14:53 27 alu seqs and pcr 000252 90/11/02 15:54 19 PCR cloning 000254 90/10/28 12:41 38 Re: inverse PCR 000255 90/11/02 14:54 27 alu seqs and pcr 000256 90/11/05 09:27 16 Re: Oligonucleotide probing 000257 90/11/05 11:50 22 PCR CLONING 000258 90/11/05 17:54 21 re:PCR CLONING 000259 90/11/05 17:03 20 000260 90/11/08 13:49 29 PCR Machine 000266 90/11/10 01:58 45 Re: PCR Machine 000279 90/11/15 17:32 26 Re: PCR Machine 000288 90/11/26 23:39 19 about PCR problems 000289 90/11/26 23:15 25 Re: about PCR problems 000300 90/12/12 20:54 35 PCR Cloning - TA Cloning system 000302 90/12/13 14:04 33 PCR cloning 000314 91/01/08 23:20 24 Anyone done PCR directly from cells 000315 91/01/08 23:04 24 Re: Anyone done PCR directly from cells 000316 91/01/10 07:36 15 Re: Anyone done PCR directly from cells 000319 91/01/12 11:01 20 Re: Anyone done PCR directly from cells 000320 91/01/15 07:18 18 Re: Anyone done PCR directly from cells 000336 91/01/28 19:17 21 bacteria detection in plants 000338 91/01/31 04:44 184 seeking bacterial strains 000339 91/01/31 16:11 28 Direct PCR from Tissue Samples 000351 91/02/04 19:38 20 pcr on fixed samples 000359 91/02/18 16:14 57 message 000366 91/02/20 22:54 135 message 000391 91/03/06 13:41 16 PCR 000401 91/03/11 00:54 21 Help: DNA from Clostridium spores 000404 91/03/12 15:53 30 PCR fragment cloning into m13 vectors 000406 91/03/12 15:57 61 Re: PCR frag. cloning into M13 vectors 000407 91/03/12 13:39 33 Re: PCR fragment cloning into M13 vectors 000416 91/03/15 17:30 47 Re: PCR fragment cloning into m13 vectors 000418 91/03/15 17:58 50 Re: PCR fragment cloning into m13 vectors 000433 91/03/30 21:34 74 Why does RAPD mapping work? 000439 91/04/06 02:55 116 Re: Why does RAPD mapping work? 000449 91/04/12 17:24 352 Re: Why does RAPD mapping work? SUMMARY 000456 91/04/23 18:15 40 PCR primer sequence collection 000459 91/04/26 18:30 22 Genomic substraction 000461 91/04/29 09:49 36 Reverse Transcription and PCR 000464 91/04/29 19:40 99 Re: Genomic substraction (fwd) 000470 91/05/03 18:37 20 Unreliability of PCR machines in time 000471 91/05/03 20:32 12 PCR 000472 91/05/06 16:59 28 000481 91/05/14 17:27 14 pcr MACHINE 000482 91/05/15 09:38 21 Facilities-Primers Design? 000483 91/05/14 19:31 44 PCR Machine-MJ Research 000485 91/05/15 10:16 16 RE: pcr MACHINE 000506 91/05/29 18:20 170 summary of *oligo construction programs* 000508 91/05/30 16:29 23 PCR references? ****************** END ************************ Rob "I'd rather see a sermon than hear one" Harper P.S. This months special offer: I will do LDBASE searches for anyone who wants to recover old messages from LISTSERV and provide them with an INDEX of entries... but they with have to finish the job off themselves and do the actual recovery by BATCH MAIL. Looking forward to hearing from you. From pollanen@csc.fi Day Mar 12 15:53:21 GMT 1991 Newsgroups: bionet.molbio.methds-reagnts Subject: PCR fragment cloning into m13 vectors Message-ID: <1991Mar12.155321.1@csc.fi> Date: 12 Mar 91 15:53:21 GMT Sender: usenet@nic.funet.fi Lines: 20 Status: O Hello Can anyone help me with m13 cloning I have some problems with ligation a PCR product into m13 vector (m13mp18) The size of fragments is varying from about 100bp to 300bp size in lenght. I have opened the m13 vector by pstI /HindIII double digestion and also I have digested these PCR products same way because we have planned primers so that PCR is (probably) producing pstI and HindIII sites to the ends or near of the ends of these fragments.... If anyone has tried to introduce DNA fragments into m13 vector please let me know of the problems and how did you solve those problems... Especially talking about PCR fragment cloning into m13 and also into expression vectors too... Sincerely yours Raimo Pollanen (M.S.) Pollanen@CSC.FI From bhjelle@vaxine.unm.edu (Brian Hjelle) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: pcr cloning Message-ID: Date: 4 Sep 91 18:39:51 GMT References: <9109041300.AA06628@genbank.bio.net> Distribution: bionet Organization: University of New Mexico, Albuquerque Lines: 36 Status: O In article <9109041300.AA06628@genbank.bio.net> suter@vax.mpiz-koeln.mpg.dbp.de writes: > > >dear netters, > >a lot has been said here about the cloning of PCR products, >and I have read lots of usual advice on this topic in the >last two or three years. > >However, i now have a *hammer* pcr product of 1000 bp which >i have been trying to clone for 1 month, and it just won t >work ! > >I have tried it blunt end, with restriction enzymes, by generating >lots of colonies and then colony hybridization, etc. etc. >The vector(s) appear to be o.k. > >So my questions are: do you have a suggestion what I could do ? >I must state that I have cloned "numerous" other PCR fragments >(o.k., with difficulty, but nothing like this). I have a radical suggestion. Put it into lambda. I don't know what sites you have, but the ZAP 2 vector has a polylinker of about 5 sites, and probably includes a blunt end site. Your odds should improve when you screen, say 10-30K plaques!! > >Secondly: DOES ANYBODY OUT THERE KNOW WHY THIS IS SO HARD ?? >What is the difference between a piece of normal DNA and a PCR >product ? I wish I did, but I don't think any of the things you suggested are right either. I have had the same problem on several occasions. Brian From drs10@po.cwru.edu (David Samols) Newsgroups: bionet.molbio.methds-reagnts Subject: Blunt Cloning PCR products Message-ID: <1991Oct16.190849.293@usenet.ins.cwru.edu> Date: 16 Oct 91 19:08:49 GMT Sender: news@usenet.ins.cwru.edu Reply-To: drs10@po.cwru.edu Organization: CWRU Department of Biochemistry Lines: 6 Nntp-Posting-Host: meds38936.bioc.cwru.edu Status: O We are having trouble cloning a PCR product and would like to have some advice/protocols on successfully blunt-end cloning the same. Dr. D. Samols From suter@vax.mpiz-koeln.mpg.dbp.de Newsgroups: bionet.molbio.methds-reagnts Subject: pcr cloning Message-ID: <9109041300.AA06628@genbank.bio.net> Date: 4 Sep 91 13:59:29 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 49 dear netters, a lot has been said here about the cloning of PCR products, and I have read lots of usual advice on this topic in the last two or three years. However, i now have a *hammer* pcr product of 1000 bp which i have been trying to clone for 1 month, and it just won t work ! I have tried it blunt end, with restriction enzymes, by generating lots of colonies and then colony hybridization, etc. etc. The vector(s) appear to be o.k. So my questions are: do you have a suggestion what I could do ? I must state that I have cloned "numerous" other PCR fragments (o.k., with difficulty, but nothing like this). Secondly: DOES ANYBODY OUT THERE KNOW WHY THIS IS SO HARD ?? What is the difference between a piece of normal DNA and a PCR product ? To start this discussion, here are some of my ideas: 1. dNTPs are somehow modified before incorporation (because of extended periods at 93 degr. C ?) 2. Primers sneak into the ds DNA fragment (like when you sequence with ds plasmid), and you get a DNA molecule with locally 3 strands 3. the fragments are not double stranded, but single stranded. 4. some other aggresive modification is taking plac ?? 5. Taq Polymerase sticks to the ends of the fragment (like CIP) and is hard to remove. 6. some component in the reaction inhibits t4 ligase all these *brainstorm* suggestions would hamper ligation. Perhaps you have another idea also, please post it to the net. furious, C. Suter-Crazzolara ************************************************************** disclaimer: naturally we use only perkin elmar Taq for our reactions (the other suppliers havent got the patent) ************************************************************* From mcgraw%gandal.dnet@SERVER.UGA.EDU Newsgroups: bionet.molbio.methds-reagnts Subject: RE: PCR cloning into T-vectors Message-ID: <9202191445.AA15146@server.uga.edu> Date: 19 Feb 92 14:45:07 GMT Sender: kristoff@genbank.bio.net Distribution: bionet Lines: 30 Bill, Re cloning into home-made T-vector: Our experience with this is limited to M13 cloning of PCR products. It works for us. As is usually the case with M13, smaller products clone more readily than big ones. We have had success with some inserts >1 kb, however. I guess the backgrounds (blue and white) are higher than what you would get with a restricted/dephophorylated vector. When it works, you see a lot more whites in the insert ligation than in the no insert control (at least 2x, some times 10x). Without seeing the increase over control, there is not much reason to pursue it. To improve, I would re-make the vector or re-do the ligation with greater amount of insert. Once you get a lot of whites, you do have the option of screening with one of your primers labelled to identify your clone. I imagine that increasing the dNTP concentration during PCR might also help to promote extra addition of A's to the PCR product. That's a speculation. Sorry this approach didn't go smoothly for you. I think it's worth another try. To me, the main advantage of this over commercial T-vectors (aside from cost) is that it allows you (in principle, at least) to use whatever vector you want. Good luck. Al McGraw University of Georgia mcgraw%gandal.dnet@server.uga.edu Path: bionet!wums.bitnet!WILSON_R From WILSON_R@wums.bitnet Newsgroups: bionet.molbio.methds-reagnts Subject: PCR cloning Message-ID: <9012132014.AA02624@genbank.bio.net> Date: 13 Dec 90 20:04:00 GMT Sender: daemon@genbank.bio.net Lines: 25 Hi! I thought I might say a word or two in response to recent inquiries about cloning PCR products. As far as the concept of Taq DNA pol leaving an overhanging A residue at the 3' end of PCR products, I'd say that the A (or some other base) is not there in some percentage of the DNA. You certainly can clone PCR products in a blunt end site with very good efficiency with no other post- (or pre-) PCR treatment than kinasing. If we add T4 DNA pol to the PCR mixture immediately following PCR, and incubate at 37 degrees for 15 minutes, cloning efficiency is doubled. Thus, your overhanging base. A 1-hour treatment at 15 degrees with a few units of Klenow seems to work fine also. You guys not wanting to spend the bucks on those TA cloning kits might want to consider this method. Good Luck! R. Wilson, St. Louis Path: bionet!susssys1.rdg.ac.uk!skspoidn From skspoidn@susssys1.rdg.ac.uk (Mike Poidinger) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: DIGESTION OF PCR PRODUCTS Message-ID: <10712.9204101308@subnode.susssys1.rdg.ac.uk> Date: 10 Apr 92 13:08:21 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 64 In response to: ----- Begin Included Message ----- Message-Id: <9204091841.AA13249@genbank.bio.net> From falquet@ch.unige.sc2a Subject: Re: DIGESTION OF PCR PRODUCTS Date: 9 Apr 92 13:20:45 GMT Status: R In article <9204010949.AA16192@genbank.bio.net>, UDHA094@OAK.CC.KCL.AC.UK (MARCEL KUIPER) writes: > > Dear colleagues, > > > I am trying to introduce restriction sites at the 5' and 3' end of PCR > products, to ligate the digested product in a vector. Until now I've > been unsuccesfull in doing so. At the 5' end I've introduced a KpnI site > with 6 bp in front of it; at the 3' end I've introduced a BglII site with > 2 bp extra at the 3' end (should be sufficient according to the New England > Catalog). > After PCR, I treat the products with Proteinase K to remove Taq polymerase > sticking to the ends, and digest the product with the restriction enzymes > and ligate it into a vector digested with KpnI and BglII. > Unfortunately, the transformed ligation product doesn't yield any colonies. > Can someone help me solve this problem? > > Thanks very much in advance, > > > Marcel Kuiper. It is always difficult to cut close to the ends of a PCR product. Try: - Kinase the ends (Oligos for PCR don't have 5' phosphates) - Blunt end your PCR products with Klenow - Blunt ligate into a blunt cutted/cipped vector - Transform, miniprep, digest with KpnI and BglII (this time they cut fine) - Low melt purify your fragment - Ligate into the final vector between KpnI & BglII sites. It is longer but it works... Laurent FALQUET and Eduardo GONZALEZ (U.K. Laemmli group) ----- End Included Message ----- alternatively, try pCR 1000 from Invitrogen. It contains a blue/white pre-cut vector containing appropriate T overhangs to allow for direct cloning of PCR product (usually having a 3' A overhang). Never used it myself, but hear good things about it from Iain McGill (I.mcgill@uk.ac.crc). It does cost a bit though. Mike Poidinger Dept of Microbiology University or Reading Path: bionet!AARDVARK.UCS.UOKNOR.EDU!BROE From BROE@AARDVARK.UCS.UOKNOR.EDU (Bruce Roe) Newsgroups: bionet.molbio.methds-reagnts Subject: Fluorescent sequencing from PCR templates Message-ID: <9112121205.AA16922@genbank.bio.net> Date: 12 Dec 91 11:56:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 59 I received the following from domi@genethon.genethon.fr Date: Thu, 12 Dec 91 10:46:10 +0100 From domi@genethon.genethon.fr Subject: Re:Fluorescent sequencing To: BROE@aardvark.ucs.uoknor.edu, domi@genethon.genethon.fr Message-Id: <9112120946.AA16284@genethon.genethon.fr> ---------------------------- hi, your responses to these questions: Topic 1: Sequencing with PCR products as templates. > > 1. What kind of success have you had with sequencing PCR products? > 2. If you have had "good" success with PCR product sequencing, how's about > passing on the protocol for PCR product isolation and the sequencing > conditions? > > Topic 2: > > 1. What kind of success have you had with sequencing with dye-terminators? > 2. Same as above.. could you share your protocol? 1- Sequencing PCR. As a rule we have no trouble sequencing PCR products so long as the original PCR gave a relatively clean Product (ie, NO products with electrophoretic mobilities lower than the product to be sequenced, and low background fog). In this case we do not isolate the PCR product but sequence it directly from the PCR filtered reaction. If the PCR is messy, we do a short (15 cycles) re-amplification of the band to be sequenced, ie the band is cut out from a low melting gel, the gel slice is molten at 65 *C and an aliquot (10-15*l) used directly for re-amplif. If the PCR is relatively clean then we proceed directly as above. We sequence using fluorescence labelled ddX and have no trouble reaching 400-500 bases with a good accuracy (over 98%). However, some PCR products, particularly those carried out from cloned DNA (YACs, cosmids, lamda libraries) often give very messy products with very high background. In these cases even what looks like a single band on gel very often contains a variety of PCR products with homogenous sizes giving useless sequences. We deal with those by isolating the band from a low melting gel, diluting the molten slice by a factor of 5 or 6 and carrying out serial re-amlpifs. That seem to work quite well. 2- sequencing with labelled ddX: we use these on DS DNA or SS DNA when we do reverse sequences. In general, if it was'nt for the unreadable first 20 or so bases typical of DS sequencing, we would not be abble to tell the difference between these and standard SS m13 sequences using labelled primers. In terms of read-lengths there is only a small difference (500-600 on SS DNA by standard methods versus 450-550 on DS DNA by labelled ddX). With respect to protocols: no problems sharing them with others. we are in the process of publishing the lot. bye dominique (communication officier for genethon-ceph) ----------------------- Cheers.........Bruce Path: bionet!bio.embnet.se!biobase!brian From brian@bio.aau.dk Newsgroups: bionet.molbio.methds-reagnts Subject: PCR product on HPLC Message-ID: <1992Feb15.125543.286@bio.aau.dk> Date: 15 Feb 92 11:55:43 GMT Organization: BIOBASE, Denmark Lines: 14 Hi! Has anyone tried to separate PCR product on HPLC ? Currently I have a problem getting separation of two PCR product which is very similar. The only difference being a deletion of 70 base pair. I am using a TSK-DEAE-NPR column, this column is capable of separating a PBR322 HAEIII digest, and especially it is capable of separating the fragments with sizes of 400 - 500 base pair. My PCR products is 430 and 500 base pairs, when they are run in separatly there is a small but significant separation between them, but when run together they elute as a single broad peak. I hope that there might be someone out there with expirence in separating DNA on HPLC. Peter Path: bionet!manvax.bitnet!SCF7 From SCF7@manvax.bitnet ("MYRNA E. WATANABE") Newsgroups: bionet.general Subject: PCR & Cloning Courses Message-ID: <9106070353.AA16257@genbank.bio.net> Date: 7 Jun 91 01:14:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 46 Subject: PCR and Cloning Courses To: bionews@genbank.bio.net There was an error in the zip code in the previous posting of this message. The correct message follows. Two courses are being offered at College of Mt. St. Vincent, Bronx, N.Y. They are: DNA AMPLIFICATION BY PCR* July 8 Introductory level 1 day 75% labwork, 25% lecture amplification of DNA from human hair magnesium titration Maximum enrollment, 16 *The Polymerase Chair Reaction (PCR) process is covered by patents issued to Cetus Corp. and the use of the process requires a license from the patent holder. BASIC CLONING TECHNIQUES July 9-12 introductory level 4 days 75% labwork, 25% lecture restriction enzyme analysis agarose gel electrophoresis transformation of E. coli Southern blotting non-radioactive hybridization analysis plasmid purification maximum enrollment, 16 For registration and additional information contact: Dr. Frances Cardillo Biotechnology Program Manhattan College\ College of Mt. St. Vincent Bronx, NY 10471 Tel.: 212-549-8000 x367 FAX: 212-549-0915 (Please do not send e-mail replies to the return e-mail address.) Path: bionet!NRCCAD.NRC.CA!NUM208JN From NUM208JN@NRCCAD.NRC.CA (John Nash) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: PCR frag. cloning into M13 vectors Message-ID: Date: 12 Mar 91 20:57:00 GMT Sender: daemon@genbank.bio.net Lines: 53 RP>Can anyone help me with m13 cloning I have some problems RP>with ligation a PCR product into m13 vector (m13mp18) RP>The size of fragments is varying from about 100bp to RP>300bp size in lenght. I have opened the m13 vector RP>by pstI /HindIII double digestion and also I have RP?di>tested these PCR products same way because we have RP>planned primers so that PCR is (probably) producing RP>pstI and HindIII sites to the ends or near of the ends RP>of these fragments.... If anyone has tried to introduce RP>DNA fragments into m13 vector please let me know of RP>the problems and how did you solve those problems... RP>Especially talking about PCR fragment cloning into RP>m13 and also into expression vectors too... I haven't tried M13 but have tried the following protocol using BRL's phagemid (pUC derivatives). I cut the vector with HincII, and do a standard pcr reaction to get insert DNA. After the pcr reaction, separate the reaction from the mineral oil, add approx. 10 units of T4 DNA Pol, incubate it at 37deg for 30 min, and gel purify the fragment. I ligate this DNA (1 or 2 ul) with the vector (25 ng), electroporate into DH5alpha cells and plate for colonies on ampicillin/xgal media. I usually get 100 to 200 colonies per plate with about 5% to 15% white colonies. I ignore this, because in the case of two 600 bp pcr products, the correct clone (identified by subsequent sequencing) was light blue on xgal plates! I do colony lifts using the gel-purified pcr product as a probe, and usually about 5 to 15 colonies (per plate) give signals. It has worked for me at least a half-dozen times. Another thing of interest... yesterday, I ran across an NAR paper that was titled "Improved cloning efficiency of polymerase chain reaction (PCR) products after proteinase K digestion." by Crowe et al., 1991. Nucl. Acids. Res. vol:19 No:1 page 184. The authors claim that Taq pol may stick to the ends of pcr'd fragments thus reducing "clonability". They claim that proK treating the fragments increases cloning efficiency umpteen fold... sounds like I may need to try this next time I have to clone a pcr product! Hope this helps... if you need more details, email me directly. cheers, John, -------------------------------------------------------------- John H.E. Nash Institute for Biological Sciences, National Research Council of Canada, Ottawa, Canada K1A 0R6. Phone: (613) 990-0990 Fax: (613) 952-9092. ============================================================== Path: bionet!agate!stanford.edu!hsdndev!nmr-z!opal.mgh.harvard.edu!cherry From cherry@frodo.mgh.harvard.edu (J. Michael Cherry) Newsgroups: bionet.software Subject: New PCR primer analysis program Message-ID: <8MAY199210472891@opal.mgh.harvard.edu> Date: 8 May 92 15:47:00 GMT Sender: cherry@opal.mgh.harvard.edu (Mike Cherry 726-5955) Organization: Molecular Biology, Massachusetts General Hospital, Boston Lines: 377 News-Software: VAX/VMS VNEWS 1.41 Nntp-Posting-Host: opal.mgh.harvard.edu A new Macintosh application for use in PCR reactions was announce on the info-mac list. Below I've included a text version of this programs documentation. You can obtain a copy of Amplify from sumex-aim.stanford.edu via anonymous ftp. Look for the file: /info-mac/app/amplify-10.hqx I'm sure the various molecular biology archive will be picking up the Compactor archive of Amplify very soon. If you can't get to sumex I've also put the amplify-10.hqx file on amber.mgh.harvard.edu in the mac directory, ("cd mac" then "get amplify-10.hqx"). The author, Bill Engels, can be reached at WREngels@wisc.macc.edu -------------------------------------------------------------------------- Amplify (C) 1992 Bill Engels I. Introduction This software is for use in designing, analyzing, and simulating experiments involving the polymerase chain reaction (PCR). PCR is a technique used by molecular biologists to amplify highly selected segments of DNA. If you never heard of PCR, you probably have no use for this program. If you want to know more about the process, you can look up the book, PCR Technology, by H.A. Erlich (1989, Stockton Press). Very briefly, PCR will take a short stretch of DNA (usually fewer than 3000 bp) and increase its copy number about a million fold so that one can determine its size, DNA sequence, etc. The particular stretch of DNA to be amplified, called the target sequence, is identified by a pair of DNA primers, which are even shorter pieces of DNA (usually about 20 bp) that have been synthesized in large quantities. To use Amplify you must supply the sequences of the primers and the target DNA. The software then analyzes the combination of primers and target sequence you have chosen to determine what portions of the target are likely to be amplified. It also provides various bits of helpful information about the reaction products, primer binding sites, etc., that can help in planning a PCR experiment and designing primers. II. Quick Tutorial 1. Boot up Amplify by double-clicking on the file Primers.pri. You should now be faced with a window showing the Amplify logo. Close it to reveal another window with a list of primers. (This is just list of primers that is currently available in my lab.) The primer sequences are in the first column and their names are in the second. 2. Find the primer named 1700 and place the cursor anywhere in that line. Then select Use this Primer from the menu, or hit -1. That will open another window, and add primer 1700 to the list of primers that will be used. Then do the same for primer 2230. 3. Next, open a file of target DNA by selecting Open Target Sequence from the File menu, or by hitting -O. Find the file called P Element.seq. (This is the sequence of the P transposable element in Drosophila melanogaster. ) 4. You have now specified everything needed for a PCR experiment. So pick Run PCR ( -3) from the PCR menu. A map showing the PCR products will then be generated as follows: 5. The arrowheads indicate points of primer binding (darker means a better match), and the bars below the sequence are potential amplified fragments (heavier bars are expected to amplify better). Explore this result by clicking on the various elements of the map. In each case, you will get an information screen with data about the item you clicked. Note that the lighter arrowhead for primer 1700 indicates a weak match that is probably not desirable in the experiment. Click on it to see how well the primer matches the target sequence. 6. To get a closer look at just a portion of the sequence, you may zoom in on any chosen section of the map. To do this, hold the command ( ) key down and drag with the mouse to draw a rectangle around the region of interest. Then select Zoom In from the PCR menu. You can repeat the process any number of times to get even higher resolution, or else select Zoom Out to get back to the original scale. III. Working With Primer Lists To use Amplify you should keep a text file listing all the primers available to you. You can create such a list with Amplify, or else use any word processing or spreadsheet program. Each line of the list should start with the sequence of the primer (Always in the 5+ to 3+ direction) followed by a tab and then the name of the primer. The name should be short so that it will fit on the map. You can also append additional information about the primer on the same line after another tab. Amplify can accept any text file as the primer list. However, if you wish to have a double-clickable file, you must create it with Amplify's Save AsI command. In addition, the name of the file should end with .pri so that Amplify will know that it is not a target sequence file. You can edit your primer list in Amplify's Primer List window just as you would edit in any Macintosh text window. In addition, you can use the Edit menu to interchange between upper and lower case letters in order to identify any particular part of the sequence. You can also reverse the polarity of any sequence: select the portion you want to reverse, then pick Reverse Sequence from the Sequence menu. This action takes the complementary strand and displays it in the 5'->3' direction. Only the primers listed in the Primers In Use window will be involved in the amplification. You can move primers from the main list to the In Use list by copying and pasting or by picking Use This Primer ( -1) with the cursor on the primer you want to select. To remove a primer from the In Use list, you can use the Remove This Primer menu item in the same way, or else simply erase it as you would any text. IV. Working With The Target Sequence Amplify can read DNA sequence information from any text file. If you create a text file with Amplify's Save AsI command, it will have the Amplify icon and be double-clickable to open the Amplify program. The target sequence text can have an optional header section before the actual sequence starts. This header can consist of anything you like provided it ends with two periods (..). Anything following the .. is taken to be part of the sequence. If you wish to use a header that includes .. as part of the text, you can use the Preferences command to change the header delimiter to any two-character string. Whenever you use the target sequence, Amplify attempts to put the DNA into a standard format. It removes any characters other than A, T, C and G, plus the corresponding lower-case letters and arranges the sequence in 80-character lines. This reformatting is done only to the sequence part of the text, and not to the header. You can change the number of characters per line to something other than 80 with the Preferences command. You can edit the target sequence window as you would any Macintosh text. You can also use the upper- and lower-case commands as well as the Reverse Sequence command as described previously in part III. You can search the sequence using the Find Pattern ( -F) command. This command is better for searching sequences than the usual find command available in most text editors, including the one in the Edit menu of Amplify. With the Find pattern command you can search in both orientations if you wish, and line breaks are ignored in the search. In addition, you can specify a maximum number of allowable mismatches in the search pattern. Once you have found the pattern, you can find the next occurrence with the Find again ( -G) command. Use the Select SequenceI command to select a stretch of sequence according to its coordinates, and the Get sequence info ( -I) command to see size, base composition, etc., of any selected portion of your sequence. V. The Run PCR command The Run PCR ( -3) command is what does the real work. Before you use this command, you must have loaded a target sequence and put at least one primer into the Primers In Use window. The Run PCR command performs the following series of actions: 1. The target sequence is formatted as described above. If it has already been formatted and no editing has been done since then, this step is skipped. 2. Each selected primer is checked against itself and all the others to determine if any are likely to form dimers. 3. The target sequence is searched in both directions for matches to the primers you have selected. Two criteria called primability and stability are used to estimate how likely a given match is to contribute to the amplification reaction. More about these later. 4. Each primer match that qualifies under both criteria is used to screen for possible amplified fragments. Each such fragment is evaluated to determine its probable degree of amplification depending on the quality of the matches involved, the length of the sequence, it's GC content, etc. 5. The results of this analysis are displayed graphically to show the matches and the amplified fragments. If any potential dimer-forming pairs are identified, they are shown also. VI. Working with the amplification map Matches and Fragments The target sequence is represented as a horizontal line with tick marks every 100 bp. Any matches between the primers and the target sequence are shown as arrowheads. Rightward-directed matches are above the line and leftward ones below. Segments of the target sequence that are candidates for amplification are shown as bars below the target sequence. They are drawn starting with the RbestS fragments on top, i.e., those expected to have the greatest abundance following the PCR. The primer matches and amplified fragments are drawn so that darker fills and heavier lines correspond to better matches or amplification. This scheme is intended only as a rough guide to the quality of the matches and strength of the amplifications. Be sure to click on anything of interest to get more information. Primer Dimers If any potential dimer-forming pairs are found, they are listed below the rightward matches and above the amplified fragments. There is no theory to predict with much confidence whether dimers will actually form, but the ones identified by Amplify should include most of the likely candidates. The algorithm was designed to be conservative, so that some potential dimers will be shown even though they will not cause trouble in a real experiment. Be sure to click on the dimer warnings to see how the match is formed. For example, clicking on one dimer warning might bring up the following text: 5+ 2611 ATCAACATCGACGTTTCCAC................. 3+ ||| 3+ .................GTGGCTTTGACGCCTGAAGA 2465 5+ This indicates that primers 2611 and 2465 can pair at their 3+ ends, possibly allowing strand extension to form a dimer. However, there are only three base pair matches, and one of them is A-T. Therefore, this dimer might not be a problem. One the other hand one like this: 5+ 2361 CCTTTGCCCAGTCGTACGAC................ 3+ |||| 3+ ................GCTGCGTTCCTCATCGGCTG 2360 5+ is potentially much more serious. And this one: 5+ 2361 CCTTTGCCCAGTCGTACGAC.......... 3+ |||||||||| 3+ ..........CAGCATGCTGACCCGTTTCC 2361 5+ will almost certainly kill the reaction. Amplify also includes the commands Check This Primer and Check all Primers to help you in designing new primers. If you place your cursor on any primer in your main list and choose Check This Primer, it will search for potential dimer-forming combinations between the selected primer and all others in the list. If you select Check All Primers, the program will make a table of all potential dimer-forming pairs from your list. You can change the parameters to make the dimer search more or less sensitive by altering the values in the dialog box invoked with the Change Dimer Parameters command. The default settings are from empirical rules based on results from my own lab. You can set the minimum length of the overlap required and the number of mismatches allowed computed as a function of the number of matches. Changing the Resolution In some cases you will want to increase the resolution of the map for a certain area. For example, it might happen that two primer matches are so close together that their arrowheads overlap and their names are difficult to read. One thing you can do is click on them. That will put information about both matches in the Info window. Another approach is to use the Zoom In feature of Amplify. To do this, you must hold down the command ( ) key so that your cursor becomes a + sign. Now drag with the mouse to make a rectangle on the screen. The left and right sides of the rectangle will determine which section of the sequence will be magnified in the close- up view. (The top and bottom of the rectangle are not important.) Now select Zoom In from the PCR menu. You can repeat this process to get as much resolution as you need to distinguish the overlapping primer matches. To return to the original scale, select Zoom Out. Saving and Exporting Graphics You can save the map as a PICT file or copy it to the clipboard for pasting into another application. However, you must choose Select All ( -A) with the graphics window open before you perform the Copy of Save AsI operation. Alternatively, if you want to copy just a portion of the map and donUt object to a jagged picture, you can do the following: First hold down the command ( ) key and drag with the mouse to draw a rectangle around the portion you want to copy. Then select Copy Pixels from the Edit menu. Note that this method copies a pixel map rather than an object-oriented image. VII. Primer Matches Amplify uses two measures of the quality of a primer match. Both depend on how many G-C and A-T hydrogen-bonding pairs can form, but they weight the pairs in different ways. Primability gives most of the weight to the pairs near the primerUs 3+ end. Thus it is a measure of how easily the DNA polymerase will be able to extend the sequence at that end. Stability is a measure of how tightly the primer and target are bound irrespective of where the matching pairs lie. For stability, G-C pairs are counted more heavily than A-T pairs and runs of matches are given more weight than singlets. Consider the match below, which is shown as it would appear in the Info window. Primer: 2607 -------------------- Primability of Match = 100% Stability of Match = 75% 5+ 3+ GCCGAAGCTTACCGAAGTAT |||||||||||||||||||| ATAACATAAGGTGGTCCCGTCGAAAgccgaagcttaccgaagtatACACTTAAATTCAGTGCA CGTTTGC | | 35 54 The primability is 100% because all 20 nucleotides match. The stability is only 75% because not all of the pairs are G-C. Here is another example: Primer: 2402 -------------------- Primability of Match = 73% Stability of Match = 42% 5+ 3+ CAACATCGACGTTTCCACATC | |||| |||| ||| | TGGTGGACAAAGAGCTACGTTCAATTCCGACGACATTTCTACAGCTATTTGTCTCC ACACCGCAGGCCCT | | 684 704 In this case there are several mismatches bringing the primability down to 73%. The most important one is the T-G mismatch in position 19. The stability is also reduced. When Amplify scans the target sequence, it keeps only matches in which both the primability and stability are above a given cutoff point. In my experience, setting the primability cutoff point at 70% and the stability cutoff at 40% retains almost all matches that work for PCR, and it eliminates the majority of the matches that donUt work. These values are used by Amplify as the default cutoff points. They tend to be on the conservative side, meaning that they are more likely to let a non-working match be shown than to eliminate a working match. If you wish to change the settings, you can do so by selecting the Set Match ParametersI item in the PCR menu. You can also experiment with the relative weights given to A-T and G-C pairs, the progression of weights from 3+ to 5+ used by the primability measure, and the relative weights given to runs of matches depending on the length of the run for the stability measure. However, remember that if you change any of these settings they will not take effect until you invoke the Run PCR command. VIII. Miscellaneous Window Settings All the windows of Amplify can be size-adjusted and moved around the screen to suit your tastes and hardware. You can also change such things as the tab settings with the Editor Setup command in the Edit menu. Use the Save Settings command to save your window arrangements and settings for the next time you run Amplify. Default Settings You can change the default settings for primer matches, dimer checking, formatting of the target sequence, etc. by editing the STR# resource (ID = 5001) with a resource editor such as ResEdit. The first string in the list names the parameters whose defaults are in the second string. The third string names the fourth, and so on. Limits The current version of Amplify has the following upper limits: length of target sequence 30,000 bp number of primers in main list 1000 length of primer sequence 100 bp number of primer matches in each direction 30 number of amplified fragments 100 number of primer dimers displayed 10 number of primers used for an amplification 20 On-Line help A condensed version of this manual is available from within Amplify if you need it. Just select a topic from the Help menu. About Amplify Amplify was written in Lightspeed Pascal using the programming modules from FaceWare. Support for its development was provided by Apple's Rota project. Beta tester Greg Gloor made many helpful comments and suggestions. I hope to add more features to Amplify when I get time. These include restriction site mapping, gel simulation, sequence searching with gaps allowed, inverse PCR, and perhaps more accurate evaluation of primer matches and dimer formers. If you have any ideas or comments, you can send them to me by e-mail: WREngels@wisc.macc.edu. If you don't use e-mail, send them to William Engels, Genetics Department, University of Wisconsin, 445 Henry Mall, Madison, WI 53706. Path: bionet!uwm.edu!ux1.cso.uiuc.edu!midway!quads.uchicago.edu!rout From rout@quads.uchicago.edu (Mark Routbort) Newsgroups: bionet.molbio.methds-reagnts Subject: Cloning PCR fragents into vector Message-ID: <1990Sep12.143937.7896@midway.uchicago.edu> Date: 12 Sep 90 14:39:37 GMT Sender: news@midway.uchicago.edu (News Administrator) Organization: University of Chicago Lines: 38 I'm looking for someone with experience cloning medium sized (500-1000 bp) PCR fragments into a vector for screening. I'm having troubles getting transformants to screen. I discovered through a control experiment that Bluescript vector that I had cut, blunt-ended with T4 polymerase, phosphatased with CI alkaline phosphatase, and then kinased with T4 polynucletide kinase would NOT yield Amp resistant colonies. Unfortunately I don't have the cut, blunted, unCIAPed vector to determine if the problem lies with blunting or with kinasing (although either is a problem, since I have to both blunt and kinase the PCR fragements). The sequence of steps on the above control was: 1) Cut CsCl-pure DNA (of a clone that has a 3 Kb insertion into SmaI site of Bluescript) with Asp718I, XbaI, and StuI (which cuts not in vector but in insert so I could distinguish vector fragment from insert). phenol/CHCl3/EtOH. 2) T4 polymerase to hopefully blunt. phenol/CHCl3/EtOH. 3) Calf intestinal alkaline phosphatase. Heat inactivate in presence of EDTA (15' at 65 deg C). Prep gel. Cut out and elute 3 Kb Bluescript fragment. Phenol/CHCl3/EtOH. 4) Rephosphorylate with T4 polynuc. kinase. 5) Use 100 ng of DNA in kinase buffer to ligate with 10 units T4 ligase overnight at 12 deg C. 6) Transform into XL-1 competent cells. No colonies next day. I've never had problems ligating or transforming before using cohesive or blunt ends (directly from enzymes), so I think the problem lies either with the kinase or the polymerase (both brand new). Has anyone had similar problems and resolved them? Unfortunately I _can't_ cut the PCR fragment and ligated with cohesive ends on both sides, although I can do so on _one_ side. Thanks for any tips, insights, and sympathetic commiserations. -- Mark Routbort Due to circumstances beyond my control, rout@midway.uchicago.edu There will be no big parade this Sunday. -- Colonel Scheisskopf in Catch-22 Path: bionet!vme.ccc.nottingham.ac.uk!Chris_Jones From Chris_Jones@vme.ccc.nottingham.ac.uk Newsgroups: bionet.molbio.methds-reagnts Subject: PCR CLONING Message-ID: <_5_Nov_90_11:50:03_A10634@UK.AC.NOTT.VME> Date: 5 Nov 90 11:50:03 GMT Sender: daemon@genbank.bio.net Lines: 14 I've Recently noticed an ad for Invitrogens PCR cloning kit where they say that Taq always adds an extra A to the 3' end of a fragment being amplified. Does anyone have any info (reference?) on this i.e. is it True? I cant find any reference to this activity in the PCR textbooks. I've successfully cloned lots of PCR products in the past but as I put sites on the ends I've never looked for extra A's. Apologies if you've read this before but my mail failed last time Thanks Chris Jones Biochem Dept Nottingham Univ. Path: bionet!vme.ccc.nottingham.ac.uk!Chris_Jones From Chris_Jones@vme.ccc.nottingham.ac.uk Newsgroups: bionet.molbio.methds-reagnts Subject: PCR cloning Message-ID: <_2_Nov_90_15:54:07_A10C2F@UK.AC.NOTT.VME> Date: 2 Nov 90 15:54:07 GMT Sender: lear@genbank.bio.net Lines: 11 I've just seen an ad for Invitrogens PCR cloning kit where they claim that PCR products always have a 3' A added on. Does anyone know anything about this (reference?). I have always done a klenow step before cloning but didn't realise that the ends were ragged because extra bases were added on? Quite a few of my applications would be wrecked by an extra A so any tips about eliminating them (if they exist) would be great. Chris Jones Biochemistry Dept Nottingham Univ. U.K. Path: bionet!news.cs.indiana.edu!att!pacbell.com!mips!spool.mu.edu!uunet!psinntp!nstn.ns.ca!ac.dal.ca!nbr From nbr@ac.dal.ca Newsgroups: bionet.molbio.methds-reagnts Subject: Re: HELP with PCR cloning Message-ID: <1991Oct23.161612.1727@ac.dal.ca> Date: 23 Oct 91 19:16:12 GMT References: <1441@chem.ucsd.EDU> Organization: Dalhousie University, Halifax, Nova Scotia, Canada Lines: 19 In article <1441@chem.ucsd.EDU>, hsb@chem.ucsd.edu (Hirdeypal S. Bhathal) writes: > I tried to subclone RACE PCR products into Hinc II site of pUC-19 after > blunt ending them with T4 polymerase. On gel, it seems that the ligation worked > but I never got a white colony. I am planning to do PCR with primer having > Eco RI site. I'll appericiate if anyone can give some suggestion. > Thanks > > Hirdeypal > hsb@chem.ucsd.edu > Have you looked at the blue colonies? We found that the blue or light blue ones sometimes carried the cloned PCR fragment, and we no longer do colour screening. Now we use PCR to amplify any insert DNA directly from a small bit of cells picked from each colony, followed by electrophoresis in agarose. Bruce Ramsey Marine Gene Probe Lab Dalhousie University Halifax, Nova Scotia Canada Path: bionet!CSC.FI!WALLEN From WALLEN@CSC.FI Newsgroups: bionet.molbio.methds-reagnts Subject: re:PCR CLONING Message-ID: <0BB03F5975BFC0B420@CSC.FI> Date: 5 Nov 90 17:54:00 GMT Sender: daemon@genbank.bio.net Lines: 13 Dear Chris, A reference that may be of interest to you is Perkin Elmer's newsletter (Amplifications, May 1990, Issue 4). There is an article called "DNA generated by PCR (...) has non-template nucleotide additions: Implications for cloning PCR products. They suggest using Klenow to remove the extra nucleotide (which probably is an A). Hope this is of some help to you. Mika Wallen Univ. Tampere Finland wallen@csc.fi (Internet) wallen@finfun (EARN/Bitnet) Path: bionet!bcm!cs.utexas.edu!swrinde!zaphod.mps.ohio-state.edu!rpi!news-server.csri.toronto.edu!utgpu!cunews!nrcnet0!MBDS.NRC.CA!NUM208JN From num208jn@MBDS.NRC.CA (John Nash) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Ligation of PCR products Message-ID: <1991Jul19.131027.10619@nrcnet0.nrc.ca> Date: 19 Jul 91 13:10:27 GMT References: <9107182217.AA23884@genbank.bio.net> Sender: root@nrcnet0.nrc.ca (Operator) Reply-To: num208jn@MBDS.NRC.CA Distribution: bionet Organization: NRC, OTTAWA, ONTARIO, CANADA. Lines: 35 Nntp-Posting-Host: mbds.nrc.ca In article <9107182217.AA23884@genbank.bio.net>, ST403161@BROWNVM.BROWN.EDU (Michael Newstein) writes: >I have read that it is exceedingly difficult to blunt-end ligate products from > PCR (without cleaving first in internal restriction sites). I am attempting >to clone the product of a PCR reaction into a blunt end cutter site (eg SMA 1) >in pBluescript. Does anyone have suggestions? I'll post this to the newsgroup because it is a question which comes up from time to time. The following worked for me: After the PCR reaction, I added 10 units of T4 DNA polymerase to the sample (I didn't remove the oil, one has to careful to ensure the sample + T4 pol is well mixed). I incubated it at 37 deg for 15 min, and then did a regular clean up and agarose gel/glass milk excision of the fragment. I find that if I heat inactivate the T4 pol, it gives poorer yields... maybe going up to 70 deg sends the exo activity nuts after the pol activity has quit... who knows. There is also a methods paper (in Nucl Acids Res , I believe) that recommends a proteinase K treatment of the PCR'd DNA. The authors say that this treatment improves cloning ability of PCR products... I haven't tried it. By the way, when I cloned my 650 bp PCR product, the positive clones were all light blue.... I was cursing because the transformation plates had few white colonies. Hope this helps. cheers, John Nash, Internet: num208jn@mbds.nrc.ca Institute for Biological Sciences, National Research Council of Canada, Ottawa, Canada K1A 0R6. Disclaimer: All opinions are mine, not NRC's! Path: bionet!news.cs.indiana.edu!mips!swrinde!cs.utexas.edu!uwm.edu!psuvax1!ukma!usenet.ins.cwru.edu!po.CWRU.Edu!axa12 From axa12@po.CWRU.Edu (Ashok Aiyar) Newsgroups: bionet.molbio.methds-reagnts Subject: Cloning PCR fragments amplified from a plasmid template Message-ID: <1991Oct4.050535.11496@usenet.ins.cwru.edu> Date: 4 Oct 91 05:05:35 GMT Sender: news@usenet.ins.cwru.edu Organization: Case Western Reserve University, Cleveland, Ohio, (USA) Lines: 33 Nntp-Posting-Host: cwns6.ins.cwru.edu A friend of mine has been trying to amplify a portion of a plasmid and then clone that. He started with 50 nanograms of uncut plasmid DNA as template in the amplification reaction. Following amplification, he blunted the PCR reaction with T4 DNA polymerase. He then took 10 ul of the PCR reaction and tried to blunt end clone it into SmaI digested pUC-19. He got dozens of white colonies - most of which turned out to contain plasmids much larger than expected. After much speculation on what they could be, he has now discovered that all of them are the original plasmid that he did his amplification from. So I guess that 5 nanograms of supercoiled plasmid (that has been subjected to 35 rounds of heating and cooling), transform more efficiently than several molar excess of ligated plasmid. I thought this was interesting. Of course, the solution is that it is best to gel-purify a PCR fragment. And if plasmid DNA is to be the template, make sure that it is cut - and use as little as possible. Ashok -- Ashok A. Aiyar Department of Biochemistry CWRU Med. School axa12@po.cwru.edu aiyar@cwbio.bioc.cwru.edu Visit the IBM-PC Sig on Freenet Path: bionet!uwm.edu!spool.mu.edu!mips!zaphod.mps.ohio-state.edu!usc!rutgers!news-server.csri.toronto.edu!bonnie.concordia.ca!ccu.umanitoba.ca!frist From frist@ccu.umanitoba.ca Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Why does RAPD mapping work? SUMMARY Keywords: PCR RAPD AP-PCR RFLP mapping Message-ID: <1991Apr12.172446.6410@ccu.umanitoba.ca> Date: 12 Apr 91 17:24:46 GMT Organization: University of Manitoba, Winnipeg, Canada Lines: 341 Posted: Fri Apr 12 12:24:46 1991 =================================================================== WHY DOES RAPD/AP MAPPING WORK? Brian Fristensky, Ph.D. Dept. of Plant Science University of Manitoba Winnipeg, MB CANADA R3T 2N2 Phone: 204-474-6085 FAX: 204-275-5128 Email: frist@ccu.umanitoba.ca =================================================================== 0. INTRODUCTION I. THE TECHNIQUE for those of you just tuning in, a short description of the technique. II. PROPOSED MECHANISM a model, and its statistical justification III. AN ALTERNATIVE MECHANISM IV. THEORETICAL CONSIDERATIONS some ramifications of the model, and caveats for potential users. A. Assumptions of the model B. Imperfect priming C. Reaction dynamics V. SUGGESTED EXPERIMENTS VI. CONCLUSION VII. REFERENCES =================================================================== 0. INTRODUCTION ----------------- Recently, I posted a query regarding a new PCR-based mapping technique called RAPD (pronounced 'rapid') mapping [Williams et al.] or AP-PCR [Welsh & McClelland] that potentially could replace RFLP mapping in many cases. Since the precise mechanism behind this technique is not yet clear, I discussed possible mechanisms, and the problems with those mechanisms. Having recieved a number of replies on the subject, including some from the authors of one of the papers describing RAPD mapping, and given the subject some more thought myself, I shall herein summarize those ideas in what I hope is a coherent treatment of the subject. I. THE TECHNIQUE ---------------- RAPD/AP-PCR involves the use of short PCR primers to amplify genomic DNA, generating genotype-specific patterns of bands, which segregate just as traditional RFLP markers do. For a mapping project, the investigator will typically screen a hundred or more primers of random design, choosing primers that give a manageable number of bands (eg. 5 or 6), and of those primers, choosing as informative ones those that detect polymorphism (ie. presence vs. absence of a band) in the population. Linkage is established as with RFLPs. [Welsh & McClelland] have shown that it can also be used for classification of bacterial strains. The potential problem behind RAPD/AP-PCR is that even though the genomic DNA is not restricted, you still get discrete, reproducible banding patterns, using a single primer. Additionally, linear (as opposed to exponential) PCR would not be expected to generate sufficient signal to visualize bands in EtBr staining. II. PROPOSED MECHANISM ---------------------- In my initial posting, I suggested that RAPD mapping depends on the fortuitous occurrence in the genome of inverted repeats that can serve as template for a given primer, such that each repeat unit defines one end of a given PCR product visualized on a gel. [Welsh & McClelland] speculate that this might be the case, and suggest that imperfect primer matches may be sufficient for priming to take place. Most of the respondants to my initial posting agreed in principle that imperfect priming could be part of the mechanism. However, the situation is complicated by the observations of [Williams et al.], who showed that even a single base difference between 10-mer primers could result in a completely different banding pattern with a particular genome. It is necessary, therefore, to reconsider the seemingly unlikely hypothesis that RAPD mapping depends on _perfect_ inverted repeats, spaced at a distance of several hundred to several thousand bp. For this purpose, let's define the relevant parameters. Definitions: G genome complexity k the size of the primer d the distance between the inverted repeat units ie. typical fragment size p probability of match between two bases chosen at random For the sake of argument, let's say that the genome complexity G of an organism is 10^9. The frequency with which a sequence of k nucleotides (nt) occurs is p^k. Assuming p=0.25, the expected number of occurrences E(k) of a given k-mer in a genome of complexity G is k 9 10 E(d) = G x p , or for tobacco 10 x (0.25) = 954 per genome But that's the number of priming events at ONE position. It is easy to be misled by the observation that the probability of getting TWO priming events close together would approximate p^k squared, or about 10e-12. Antoni Rafalski (duPont) has cited the reasoning of Ken Livak and Eric Lander, who conceptualize a fragment of size d as having d chances for an inverted repeat to occur. I am embarrassed to say that I initially rejected this idea, in spite of having written a paper describing an analogous situation, in which I presented a statistical model of the frequency with which look-up table-based similarity searches find similarities at a defined level of identitiy [Fristensky]. I am now convinced that these are comparable situations. The problem can be stated as follows: given a k-mer match at one site, what is the probability P(d) of finding the inverse complement of this sequence within d nucleotides? k let P = p and Q = 1-P. Then d d i 1 - Q k d P(d) = SUM PQ = P -------- = 1 - (1-p ) 1 - Q i=1 For a given 10-mer match at a single site, the probability P(d) of getting another 10-mer match within d=1000nt is 9.5e-4, or about 1 in 1000. If this 10-mer occurs 954 times in the genome, then you have an expectation of seeing about 1 band for a typical 10 mer in the tobacco genome. This hand-waving explanation glosses over a number of points, but it shows that the inverted repeat model is consistent with the results for eukaryotic genomes. Much harder to explain are the results obtained with _prokaryotic_ genomes. Fig. 1 of the RAPD paper shows about the same number of bands for bacterial species as with plant or human genomes! Section IV discusses some of the other things that need to be considered in RAPD/AP-PCR. III. AN ALTERNATIVE MECHANISM ----------------------------- Antoni Rafalski cites another mechanism, suggested by Hemin Wu (Yale University). As illustrated in the figure below, some sequences containing a template for primer i will be able to form hairpin structures downstream of i, as indicated in step 1. Such a mechanism has been verified in 1st strand cDNA synthesis, and the amazing thing about it is that very little secondary structure seems to be necessary to make it work, as evidenced by the fact that most genes can be cloned as cDNAs in this fashion. In step 2, this hairpin elongates, creating the complementary strand, containing domain a' and i' (ie. the complements of a and i, respectively). When this duplex denatures (step 3), it forms a huge inverted repeat. The region bounded by i and i' will now amplify using primer i. i a (1) 5' -------------------------- 3'___) | self priming v i a 5' -------------------------- (2) 3' <_________________________) i' a' | duplex denatures v i a a' i' (3) 5' -------------------------------------------------- 3' This model can be tested in the following experiment: 1. dilute PCR reaction 2. denature 3. anneal for short time 4. (+) S1 digestion (-) no S1 digestion 5. run on denaturing gel 6. bands in (-) lane should be double size of (+) lane Perhaps the biggest unknown is in step 2, which will only work if Taq polymerase can extend transient hairpins as Reverse Transcriptase does. IV. THEORETICAL CONSIDERATIONS ------------------------------- A. Assumptions of the model Ron Sederoff (N. Carolina State Univ.) pointed out that any calculation of probability should be based on genome _complexity_, rather than genome size. This is very important for eukaryotic genomes, which tend to have a lot of repetitive DNA. He went on to say that even experimentally-determined estimates of complexity, which are based on reassociation kinetics, may be an overestimate of the true complexity. For example, [Murray et al.] have demonstrated that pea sequences ("fossil repeats") annealing with single-copy kinetics under standard conditions can exhibit repetitive reassociation kinetics under less stringent conditions. Another assumption is that inverted repeats occur ranomly as a function of nucleotide frequency. If mechanisms exist by which short inverted repeats are spontaneously generated, then such an assumption will underestimate their true frequency. B. Imperfect priming In spite of the fact that the random model as described in II puts the frequency of perfect inverted repeats at least in the right ball-park for eukaryotic genomes, it still doesn't explain the fact that bacterial genomes give about the same number of bands as the genomes of higher eukaryotes. The mutation-scanning experiment of [Williams et al., Fig. 2] would be consistent with the idea that more and more mismatch is tolerated with increasing distance from the 3' end. They showed that single base-substitutions anywhere in the 3'-most bases of a 10-mer resulted in completely different band patterns. However, there did appear to be several bands in common between the patterns given by the original 10-mer, and that of the 10-mer with a base substitution at the 5'end. [Welsh & McClelland] have provided further evidence for imperfect priming by doing the first two cycles with low annealing temperatures (40C), and subsequent annealing steps under more stringent conditions (60C). Their Fig.1 shows that as the annealing temperature of the first two cycles increases, bands are lost from the final population. At the same time, many users of PCR have observed that some primers that can base pair at their 3'ends can self prime, producing "primer-dimers". Primer dimers can form with as little as 2 GC base pairs. [Sommer & Tautz] have shown that 17-mers with several mismatches can still prime, provided that no mismatches occur in the 3'-most three nucleotides. Additionally, [White et al.] have shown that primer-linker pairs with only 9 base overlap can amplify into long tandem arrays (concatamers) even when annealing is carried out at temperatures far exceeding the predicted Td of the duplex. C. Reaction dynamics Keith Elliston (Rutgers), Pam Norton (Roger Williams Gen. Hosp.), John Williams (duPont) and myself all recognized the fact that early events in PCR reactions can have profound effects on the final products visualized. Remembering that each primer is physically incorporated into the strand that it produces, and is then copied faithfully in subsequent reactions, it is obvious that even imperfect priming events in the early cycles will produce templates that can be perfectly primed in later cycles. Rather than considering priming as the outcome of a match/mismatch decision, it is probably more realistic to consider priming as a function of what Ron Sederoff calls "residence time". The better duplex that can form, the more likely it is that the duplex will stay together until another nucleotide is added. Finally, it is instructive to visualize the growing population of fragments in solution as a biological community. In the early cycles, a whole zoo of sequences is likely to be present. Fairly quickly, a small number of sequences that are most efficient at replicating will be selected, and will take over the population. Again, what we see in Ethidiuim staining is the end point of the reaction. These considerations may explain the reason that both bacterial and large eukaryotic genones are able to give about the same number of bands. This observation may actually be a systematic artifact of the limitations of reagents, and competition between templates during amplification. Regardless of how many 'good' templates were available in the early cycles, the population dynamics may favor a small number of major products by later cycles, which is what we see on the gel. V. SUGGESTED EXPERIMENTS -------------------------- Perhaps the most important experiment to do would be to test the inverted repeat hypothesis by sequencing the regions flanking the ends of the RAPD/AP products. To do this, you first need to determine the sequence internal to gel-isolated fragments from RAPD/AP reactions. (Note that ends of these fragments are guaranteed to have perfect primer sequences at both ends. It is therefore necessary to directly sequence the flanking regions from genomic DNA.) Once the internal sequence can be determined, internal sequencing primers can be synthesized, and the flanking regions sequenced, without cloning, by inverse PCR, using genomic DNA as a template [Ochman et al., Triglia et al.]. Of course, sequencing the internal regions will also test the Wu model. Another experiment to try would be to simply include radiolabled nucleotide in the RAPD/AP-PCR reaction, and remove aliquots from the reaction at different cycles. Next, all aliquots would be co- electrophoresed, and the gel autoradiographed for different time intervals. Short exposures would show the relatively small number of species present by the later cycles, while long exposures would make it possible to visualize the presumptive zoo of fragments present in early cycles. In this way, it should be possible to compare the relative importance of specific priming versus competition. VI. CONCLUSION ------------- I hope I have accurately represented the views of those who responded by my initial posting, and I would like to thank all involved for the stimulating discussions and exchanges that we have had on this subject. Hopefully, the understanding of the RAPD/AP- PCR mechanism will lead to its improvement as a technique. VII. REFERENCES ---------- Fristensky B. (1986) Improving the efficiency of dot-matrix similarity searches through use of an oligomer table. NUCL. ACIDS RES. 14:597-610. Murray, M., Peters, D.L. and Thompson, W.F. (1981) Ancient repeated sequences in the pea and mung bean genomes and implications for genome evolution. J. MOL.EVOL. 17:31-42. Ochman, H., Gerber, A.S. and Hartl, D.L. (1988) Genetic applications of an inverse polymerase chain reaction. GENETICS 120:621-623. Sommer, R. and Tautz, D. (1989) Minimal homology requirements for PCR primers. NUCL. ACIDS RES. 17:6749. Triglia, T., Peterson, M.G. and Kemp, D.J. (1988) A procedure for in-vitro amplification of DNA segments that lie outside the boundaries of known sequences. NUCL. ACIDS RES. 16:8186. Welsh, J. and McClelland, M. (1990) Fingerprinting genomes using PCR with arbitrary primers. NUCL. ACIDS RES. 18:7213-7218. (Editor's note: "Publication of this paper was delayed by the authors to allow simultaneous publication with a paper submitted later by another group. Nucleic Acids Research regrets that due to administrative errors the other paper, by Williams et al., was published on pages 6531-6535 of issue 22. Both sets of authors agree that the two papers should be considered as published simultaneously and should be referred to together.) White, M.J., Fristensky, B. and Thompson, W.F. (1991) Concatemer chain reaction: A Taq DNA polymerase-mediated mechanism for generating long tandemly-repetitive DNA sequences. (submitted) Williams, J.G.K, Kubelik, A.R. Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. NUCL. ACIDS RES. 18:6531-6535. Path: bionet!uwm.edu!zaphod.mps.ohio-state.edu!magnus.acs.ohio-state.edu!usenet.ins.cwru.edu!po.CWRU.Edu!djt2 From djt2@po.CWRU.Edu (Dennis J. Templeton) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Cloning PCR fragments amplified from a plasmid template Message-ID: <1991Oct4.150714.20918@usenet.ins.cwru.edu> Date: 4 Oct 91 15:07:14 GMT References: <1991Oct4.050535.11496@usenet.ins.cwru.edu> Sender: news@usenet.ins.cwru.edu Reply-To: djt2@po.CWRU.Edu (Dennis J. Templeton) Organization: Case Western Reserve University, Cleveland, OH (USA) Lines: 48 Nntp-Posting-Host: cwns4.ins.cwru.edu In a previous article, axa12@po.CWRU.Edu (Ashok Aiyar) says: > >A friend of mine has been trying to amplify a portion >of a plasmid and then clone that. > >He started with 50 nanograms of uncut plasmid DNA as >template in the amplification reaction. Following >amplification, he blunted the PCR reaction with T4 DNA >polymerase. > >He then took 10 ul of the PCR reaction and tried to >blunt end clone it into SmaI digested pUC-19. He got >dozens of white colonies - most of which turned out >to contain plasmids much larger than expected. > >After much speculation on what they could be, he has >now discovered that all of them are the original plasmid >that he did his amplification from. > >So I guess that 5 nanograms of supercoiled plasmid (that >has been subjected to 35 rounds of heating and cooling), >transform more efficiently than several molar excess of >ligated plasmid. I thought this was interesting. Of >course, the solution is that it is best to gel-purify a >PCR fragment. And if plasmid DNA is to be the template, >make sure that it is cut - and use as little as possible. > >Ashok >-- > Ashok A. Aiyar Department of Biochemistry CWRU Med. School > axa12@po.cwru.edu > aiyar@cwbio.bioc.cwru.edu > Visit the IBM-PC Sig on Freenet > Ashok-- When we do this we cut our template first, and use enzymes that chop up our starting plasmid pretty thoroughly. A cut plasmid should amplify better too (it seems, intuitively) because of less snap-back hybridization. We also start with much less template (about 5ng in a 50 ul reaction). Then too, it's not much extra trouble to do the gel purification, as you're more certain of what you're ligating! Nice to see you here, neighbor :=) Path: bionet!agate!shelby!snorkelwacker.mit.edu!usc!samsung!sol.ctr.columbia.edu!caen!hellgate.utah.edu!linkers.med.utah.edu!linkers!launce From launce@apollo.med.utah.edu (Launce Gouw) Newsgroups: bionet.molbio.methds-reagnts Subject: PCR Cloning - TA Cloning system Message-ID: Date: 12 Dec 90 20:54:09 GMT Sender: news@linkers.med.utah.edu (Netnews owner) Distribution: bionet Organization: University of Utah Lines: 25 A little while ago discussion came up regarding Invitrogen's new TA cloning system which claims to be able to copy unmodified (i.e., no special primers needed) PCR products into their pCR2000 vector by utilizing the ragged ends generated by the terminal transferase activity of thermophilic polymerases. (How's that for a run-on sentence :-) Anyway, has anybody tried it yet? What d'ya think? After calling them, they said they don't give out trial samples. We're not quite ready to shell out the ~ $240/20 reactions they're charging, especially since we don't have enough information (anecdotal or otherwise) on the product, other than their advert blurbs and brief info flier. If anybody who's used the product or knows somebody who's used the product could reply to me (by email or by posting) I'll summarize for others who might be interested about results + feedback regarding this new tool. ADVthanksANCE -- ___ / / _____ / /___/ ___/ "What a silly bunt!" /_____ /_---- /____/ launce@apollo.med.utah.edu *** help! help! i'm being repressed!! **we apologise for the previous opinions. those responsible have been sacked** Path: bionet!news.cs.indiana.edu!mips!sdd.hp.com!cs.utexas.edu!uwm.edu!linac!att!ucbeh.san.uc.edu!penas From penas@ucbeh.san.uc.edu Newsgroups: bionet.molbio.methds-reagnts Subject: PCR Cloning & Mutations Message-ID: <1992Jan5.205431.426@ucbeh.san.uc.edu> Date: 6 Jan 92 01:54:31 GMT Organization: Univ. of Cincinnati Lines: 11 Hi! I have some clones that look like steroid hormone (zinc finger) receptors but the deduced amino acid sequence shows several termination sites internally. These genes (cDNAs) were amplified with PCR prior to cloning and then sequencing. Could these termination sites (3 within 200 bases) be the result of mutations introduced by PCR? Could they be sequencing errors? I hope some could comment on this. -- Sandra Pena de Ortiz : penas@ucbeh.bitnet University of Cincinnati College of Medicine Toxicology Program Path: bionet!manvax.bitnet!SCF7 From SCF7@manvax.bitnet ("MYRNA E. WATANABE") Newsgroups: bionet.general Subject: PCR and Cloning Courses Message-ID: <9106061515.AA25844@genbank.bio.net> Date: 6 Jun 91 15:15:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 38 Two courses are being offered at College of Mt. St. Vincent, Bronx, N.Y. They are: DNA AMPLIFICATION BY PCR* July 8 Introductory level 1 day 75% labwork, 25% lecture amplification of DNA from human hair magnesium titration Maximum enrollment, 16 *The Polymerase Chair Reaction (PCR) process is covered by patents issued to Cetus Corp. and the use of the process requires a license from the patent holder. BASIC CLONING TECHNIQUES July 9-12 introductory level 4 days 75% labwork, 25% lecture restriction enzyme analysis agarose gel electrophoresis transformation of E. coli Southern blotting non-radioactive hybridization analysis plasmid purification maximum enrollment, 16 For registration and additional information contact: Dr. Frances Cardillo Biotechnology Program Manhattan College\ College of Mt. St. Vincent Bronx, NY 10460 Tel.: 212-549-8000 x367 FAX: 212-549-0915 (Please do not send e-mail replies to the return e-mail address.) Path: bionet!bcm!cs.utexas.edu!uwm.edu!linac!att!pacbell.com!ucsd!chem.ucsd.edu!hsb From hsb@chem.ucsd.edu (Hirdeypal S. Bhathal) Newsgroups: bionet.molbio.methds-reagnts Subject: HELP with PCR cloning Message-ID: <1441@chem.ucsd.EDU> Date: 16 Oct 91 19:58:53 GMT Sender: news@chem.ucsd.edu Reply-To: hsb@chem.ucsd.edu (Hirdeypal S. Bhathal) Organization: Chemistry Dept, UC San Diego Lines: 9 I tried to subclone RACE PCR products into Hinc II site of pUC-19 after blunt ending them with T4 polymerase. On gel, it seems that the ligation worked but I never got a white colony. I am planning to do PCR with primer having Eco RI site. I'll appericiate if anyone can give some suggestion. Thanks Hirdeypal hsb@chem.ucsd.edu Path: bionet!s.u-tokyo!ccut!sun-barr!lll-winken!elroy.jpl.nasa.gov!sdd.hp.com!spool.mu.edu!munnari.oz.au!manuel!rsbs0.anu.edu.au!jjw From jjw@rsbs0.anu.edu.au Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Ligation of PCR products Message-ID: <1991Jul22.181350.1@rsbs0.anu.edu.au> Date: 22 Jul 91 08:13:50 GMT References: <9107182217.AA23884@genbank.bio.net> <1991Jul19.125921.14518@magnus.acs.ohio-state.edu> Sender: news@newshost.anu.edu.au Distribution: bionet Organization: Research School of Biological Sciences, Australian National University Lines: 36 In article <1991Jul19.125921.14518@magnus.acs.ohio-state.edu>, gchacko@magnus.acs.ohio-state.edu (George W Chacko) writes: > In article <9107182217.AA23884@genbank.bio.net> ST403161@BROWNVM.BROWN.EDU (Michael Newstein) writes: >>I have read that it is exceedingly difficult to blunt-end ligate products from >> PCR (without cleaving first in internal restriction sites). I am attempting >>to clone the product of a PCR reaction into a blunt end cutter site (eg SMA 1) >>in pBluescript. Does anyone have suggestions? > > You could try the TA cloning method. Invitrogen has a kit but it seems fairly > straighforward. There's a rapid communication in NAR 19:1154 by Marchuk, > Drumm,Saulino and Collins describing it. > > George The problem with the Invitrogen kit is the price. An alternative, suggested to me by longtime freind Mick Graham late of Calgene (Australia), was to make your own TA vector by cuting your vector of choice with a Blunt-end restriction enzyme (eg SmaI) and then tailing with dideoxyTTP. This apparently works well, and it looks a very simple approach which will allow PCR cloning more efficiently that after blunt end repairing (as it makes use of the generally A extension put on by the PCR process for base pairing during the cloning step). I gather this was written up as a note for NAR but I don't know if it's out yet. cheers, ******************************************************************************** Dr. Jeremy Weinman Plant Microbe Interaction Group Research School of Biological Sciences Australian National University Email: jjw@rsbs0.anu.edu.oz Phone: 61 6 2495051 Fax: 61 6 2490754 Snail: PO Box 475, Canberra, ACT 2601, AUSTRALIA ******************************************************************************** Path: bionet!uwm.edu!rutgers!news-server.csri.toronto.edu!utgpu!jupiter!morgan.ucs.mun.ca!kean.ucs.mun.ca!ggloor From ggloor@kean.ucs.mun.ca Newsgroups: bionet.molbio.methds-reagnts Subject: PCR cloning summary please Message-ID: <1991Oct30.123823.1@kean.ucs.mun.ca> Date: 30 Oct 91 15:08:23 GMT Sender: usenet@morgan.ucs.mun.ca (NNTP server account) Organization: Memorial University. St.John's Nfld, Canada Lines: 9 Help! I neglected to copy the consensus best method for cloning PCR reactions. Is there a place where the postings for this group is archived so that I can retreive the postings? If not, could some kind soul please summarize again? Thanks. Greg Gloor Memorial University of Newfoundland Path: bionet!news.cs.indiana.edu!att!ucunix.san.uc.edu!ucbeh.san.uc.edu!penas From penas@ucbeh.san.uc.edu Newsgroups: bionet.molbio.methds-reagnts Subject: Summary:Cloning Small PCR products Message-ID: <1991Nov18.132326.310@ucbeh.san.uc.edu> Date: 18 Nov 91 18:23:26 GMT Organization: Univ. of Cincinnati Lines: 10 Hi! There appears to be no minimum size of insert for cloning PCR products. Inserts of 100 to 200 bases are being cloned routinely by several labs. Thank you for your response. -- Sandra Pena de Ortiz : penas@ucbeh.bitnet University of Cincinnati College of Medicine Toxicology Program Path: bionet!SDSC.EDU!mws%molly From mws%molly@SDSC.EDU (Michael W. Smith) Newsgroups: bionet.molbio.methds-reagnts Subject: Cloning PCR products Message-ID: <9201280146.AA11363@molly.sdsc.edu> Date: 28 Jan 92 01:46:13 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 11 I am designing a new set of primers for PCR analysis and planning to use restriction enzyme sites for very rare cutting enzymes. The products would then be forced into a vector at those two sites. Does anyone have tales of great success or woe with the ClaI or SacII?? I am especially interested in knowing the number of extra bases incorporated into the 5' end of the PCR primer. Thanks for any help mike Path: bionet!uwm.edu!caen!kuhub.cc.ukans.edu!mbcf.stjude.org!suttle From suttle@mbcf.stjude.org Newsgroups: bionet.molbio.methds-reagnts Subject: Re: PCR fragment cloning into m13 vectors Message-ID: <1991Mar15.115833.8277@mbcf.stjude.org> Date: 15 Mar 91 17:58:33 GMT References: <1991Mar12.155321.1@csc.fi> Organization: St. Jude Children's Research Hospital Lines: 41 In article <1991Mar12.155321.1@csc.fi>, pollanen@csc.fi writes: > .... If anyone has tried to introduce (PCR) > DNA fragments into m13 vector please let me know of > the problems and how did you solve those problems... > Especially talking about PCR fragment cloning into > m13 and also into expression vectors too. I clone PCR fragments into M13 vectors all the time, by pretty much the same method you are trying to use. I design my primers so that a restriction site is included near each end. I can think of some problems that may be causing your cloning difficulties: 1. The primers should be designed so that the restriction cleavage site is near the center of @20mer. If you are hoping that the enzyme will cleave off the very last nucleotide or two of the PCR product, you may have trouble. A method was described in Nucleic Acids Research 18:6156 (1990) for "Efficient cloning of PCR generated DNA containing terminal restriction endonuclease recognition sites" In this article, Jung et al. showed that if the PCR product is generated with 5'-Phosphorylated primers and then concatemerized with T4 DNA ligase, it is more readily digested at the terminal restriction sites. I have not had a reason to try this, but it sounds reasonable. 2. The M13 DNA may not be completely digested with both PstI and HindIII. There was a BRL Focus article about double digestions of the multiple cloning site (Focus 8:3 p. 9, 1986) in which they investigated the importance of using the restriction enzymes in particular order. They found that HindIII should be used before PstI and not the reverse. Also, it would be difficult to use them simultaneously because their sites are so close together. 3. You can verify that your M13 DNA is cut by both restriction enzymes by a simple test described in FMC Resolutions newsletter vol.2 no. 3. It basically involves taking aliquots of your DNA after both the first and second restriction digestion and digesting them together with an enzyme which cuts outside of the polylinker - like MstI. This produces two pieces of DNA which differ in length by the distance between the first two sites (like PstI and HindIII). Separation on 4% NuSieve agarose makes it possible to distinguish the two bands, which may be as few as 10 bp apart. I have used this protocol many times and would be glad to fax you a copy, if you need it. If none of these ideas solves your problem, you could directly sequence your PCR product, but that involves a whole new set of problems!!! Good luck! -- Barbara Bugg (also M.S.) St. Jude Children's Research Hospital Memphis, TN at SUTTLE@STJUDE.ORG Path: bionet!citiago.bitnet!arenas From arenas@citiago.bitnet (Jaime Arenas) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Cloning PCR fragents into vector Message-ID: <9009140315.AA22202@genbank.bio.net> Date: 13 Sep 90 17:00:43 GMT References: <900912181126.30a00132@Iago.Caltech.Edu> Sender: daemon@genbank.bio.net Lines: 63 > I'm looking for someone with experience cloning medium sized (500-1000 bp ) > PCR fragments into a vector for screening. I'm having troubles getting > transformants to screen. > I discovered through a control experiment that Bluescript vector that I > had cut, blunt-ended with T4 polymerase, phosphatased with CI alkaline > phosphatase, and then kinased with T4 polynucletide kinase would NOT yield > Amp resistant colonies. Unfortunately I don't have the cut, blunted, > unCIAPed vector to determine if the problem lies with blunting or with > kinasing (although either is a problem, since I have to both blunt and kinase > the PCR fragements). Mark, I had similar problems trying to clone PCR products in bluescript. I was trying to blunt-end ligate PCR product into the SmaI site of BS. However, It never worked. Although I never knew for sure what was wrong and to make a long story short, here's what I found and how I did come out of it: 1.- I found that "blunt ending" PCR fragments with T4-pol was not needed indi- cating that there was enough blunt ended molecules in the PCR product. 2.- Always had troubles when cut Bluescript with SmaI. Then changed to EcoRV and worked just fine. 3.- After treatment of EcoRV vector with alkaline phosphatase, I removed it by phenol/chlor (ph 7.0) extraction and three chlor. extractions followed by ethanol precipitation. 4.- After PCR I phenol/chor. and etOH pp. products as above and phosphorylated them with kinase. Then isolated kinased PCR products by running Nu Sieve LMP agarose gel (SeaKem) and cut band out. 5.- Blunt end ligation works just fine adding an aliquote of the melted agarose slice up to 0.3% agarose in the ligation reaction. For this, melt agarose, mix all reagents except enzyme in another tube and heat to 50-55 celcius. Mix melted agarose and pre-warmed reagents. Put at 37 degrees and add enzyme. Leave at 37 degrees 10-15 minutes and then sit at RT for 3 hours or more. 6.- Although this was enough for me. For higher yields purify PCR products away from agarose P.S. If you are using Blue/white selection, never mind the color of the colonies when using Bluescript I. Good luck, --------------------------------------------------------------------------- Jaime Arenas, Ph.D. There is no places, Division of Biology 147-75 there is beginnings and ends, CALTECH but nothing is ever forgotten. Pasadena, CA 91125 ARENAS@CITIAGO.BITNET ARENAS@IAGO.CALTECH.EDU (NO, there are no misspellings) Path: bionet!bio.embnet.se!sunic!news.funet.fi!hydra!cc.helsinki.fi!nphi!msalminen From msalminen@nphi.fi Newsgroups: bionet.molbio.methds-reagnts Subject: Re: PCR fragment cloning into m13 vectors Message-ID: <387.27e104a7@nphi.fi> Date: 15 Mar 91 17:30:15 GMT References: <1991Mar12.155321.1@csc.fi> Organization: National Public Health Institute, Finland Lines: 38 In article <1991Mar12.155321.1@csc.fi>, pollanen@csc.fi writes: > Hello > > Can anyone help me with m13 cloning I have some problems > with ligation a PCR product into m13 vector (m13mp18) > The size of fragments is varying from about 100bp to > 300bp size in lenght. I have opened the m13 vector > by pstI /HindIII double digestion and also I have > digested these PCR products same way because we have > planned primers so that PCR is (probably) producing > pstI and HindIII sites to the ends or near of the ends > of these fragments.... If anyone has tried to introduce > DNA fragments into m13 vector please let me know of > the problems and how did you solve those problems... > Especially talking about PCR fragment cloning into > m13 and also into expression vectors too... > > Sincerely yours Raimo Pollanen (M.S.) > > Pollanen@CSC.FI Hi Raimo! You could try two things: a) after PCR add 5-10 u Klenow. This repairs the ragged ends sometimes left by Taq. Then precipitate and digest. Precipitate again and clone. If you do a Kinase reaction the yield of inserts is better. Check the size of pcr-product before cloning by gel-electrophoresis. b) Do the fill-in with Klenow and precipitate. Blunt-end clone in suitable site such as Sal1. Again, kinase gives better yield. If you need more details, feel free to contact me at msalminen@finnphi (bitnet) or msalminen@nphi.fi (Internet) or nphi02::msalminen (Decnet) Mika Salminen KTL, HIV-Unit. Path: bionet!LINDA.LLNL.GOV!fish From fish@LINDA.LLNL.GOV (chris) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: PCR fragment cloning into M13 vectors Message-ID: <9103122139.AA01190@linda.bio386> Date: 12 Mar 91 21:39:56 GMT Sender: daemon@genbank.bio.net Lines: 24 RP>Can anyone help me with m13 cloning I have some problems RP>with ligation a PCR product into m13 vector (m13mp18) RP>The size of fragments is varying from about 100bp to RP>300bp size in lenght. I have opened the m13 vector RP>by pstI /HindIII double digestion and also I have RP?di>tested these PCR products same way because we have RP>planned primers so that PCR is (probably) producing RP>pstI and HindIII sites to the ends or near of the ends RP>of these fragments.... If anyone has tried to introduce RP>DNA fragments into m13 vector please let me know of RP>the problems and how did you solve those problems... RP>Especially talking about PCR fragment cloning into RP>m13 and also into expression vectors too... An alternative and efficient cloning method for PCR products was developed by Aslanidis and de Jong (see Nucleic Acids Research, 18:6069-6074). The method does not use ligation, and the cloning efficiency is extremely high (only recombinants are produced). As mentioned by John Nash in an earlier response, small inserts give light blue colonies when a pUC-based vector is employed. Chris T. Amemiya Lawrence Livermore National Laboratory fish@amoeba.llnl.gov Path: bionet!SIMSC.BITNET!HIDEW From HIDEW@SIMSC.BITNET Newsgroups: bionet.general Subject: PCR blunt end cloning Message-ID: <9110181446.AA21557@genbank.bio.net> Date: 18 Oct 91 14:45:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 45 WRT the message posted about PCR product blunt-end cloning by Hirdeypal S. Bhathal: He inquired as to the effacy of his blunt end system, and noted that he was getting "false" white colonies after subcloning. I KNOW the story!!! Here I am also trying to do a great deal of blunt end cloning, and frankly hate it. But there is a method that DOES (I promise) yeild some results, even in the hands of a clumsy scientist such as myself. I have invested in an Invitrogen T/A cloning kit. The principle of this kit is to utilise the ragged end of the PCR product that has an extra A overhang incorporated by the action of the thermostable polymerase. The vector for this system has a (I think) HincII digested site that results in a matching overhang/end. The cloning frequency is good for the system because the kit is supplied with *VERY* high competency cells, reagents (including ligase and optimised buffer) and control elements. It is the only way I have managed to subclone my more reluctant blunt-ended PCR products. I am in no way connected to the copany that makes this thing, but feel it's OK to say it works, and works WELL. I hope that this will be of some use. I feel it pertinent to add that there is a lot of regular blunt-ended cloning done in this lab, with extremely variable results. Win Hide Lab of Molecular Systematics Smithsonian Institution (some people have nucleotide fingers....some have plain 'ol paws...) Path: bionet!rutgers!stanford.edu!agate!spool.mu.edu!umn.edu!lenti.med.umn.edu!ernest From ernest@lenti.med.umn.edu (Ernest Retzel (1535 49118)) Newsgroups: bionet.molbio.methds-reagnts Subject: Biotinylated Primers [was SS PCR] Message-ID: <1992Mar31.094150.13110@news2.cis.umn.edu> Date: 31 Mar 92 09:41:50 GMT Sender: news@news2.cis.umn.edu (Usenet News Administration) Organization: University of Minnesota Lines: 173 Nntp-Posting-Host: lenti.med.umn.edu >How about a reference or two on that. I am not sure about how to biotinylate >the primer, ie how many biotins per primer, how much does the biotin affect the >PCR reaction , and how do you determine how many/much of the magnetic particles >do you add per estimated biotin content? Generally, I put the biotin directly on during synthesis on the 5'-terminus. Cyanoethyl phosphoramidite biotin can be bought from several sources; my personal favorite is Glen Research, Inc., in Sterling, VA [800-327-GLEN; fax: 703-435-9774] [yes, all usual disclaimers]. Their only business is nucleic acid synthesis reagents, and they do it well. I am not where my paper files are [as in, I am at home...], but a quick search of MedLine with keywords "biotin*" and "magnetic" came up with the following [and a few more]; there were others with 'pcr' and 'polymerase chain reaction,' coupled with these terms, but I didn't have the patience to sort them at 9600 baud... The magnetic bead folks [Dynex?] have an extensive literature file of their own as well. Their number I don't have here. With all the usual disclaimers, they are pretty much the clear favorite, even though they are not the cheapest. Ernest Retzel Dept. of Microbiology University of Minnesota ernest@lenti.med.umn.edu *************************************************************************** AU - Kaneoka H;Lee DR;Hsu KC;Sharp GC;Hoffman RW; TI - Solid-phase direct DNA sequencing of allele-specific polymerase chain reaction-amplified HLA-DR genes. SO - Biotechniques 1991 Jan;10(1):30, 32, 34 AB - We describe in this report a new strategy to directly sequence polymerase chain reaction-amplified human leucocyte antigen DRB genes using biotinylated allele-specific synthetic oligonucleotide primers coupled to streptavidin-coated magnetic beads. The use of allele-specific primers in the polymerase chain reaction allows for selective amplification of DNA from one haplotype, which when combined with the direct sequencing technique circumvents the need for DNA cloning prior to sequencing. We demonstrate here that this method can be used to characterize human leucocyte antigen DRB genes among heterozygous individuals. This method can be used for the rapid analysis of highly polymorphic genes among individuals heterozygous at the gene of interest. AU - Shaffer AL;Wojnar W;Nelson W; TI - Amplification, detection, and automated sequencing of gibbon interleukin-2 mRNA by Thermus aquaticus DNA polymerase reverse transcription and polymerase chain reaction. SO - Anal Biochem 1990 Nov 1;190(2):292-6 ANALYTICAL BIOCHEMISTRY (NEW YORK) AB - Reverse transcription-polymerase chain reaction (RT-PCR) is a gene expression assay by which messenger RNA (mRNA) production can be measured. This technique involves three steps: isolation of RNA from cells or tissues, the creation of a DNA copy of the desired message (cDNA) by viral reverse transcriptase enzymes (RT), and amplification of this DNA segment by the polymerase chain reaction (PCR) for subsequent quantitation and analysis. Here we describe a one-enzyme, one-step method combining the RT and PCR steps of conventional RT-PCR by exploiting the recently documented RT properties of Taq polymerase, the thermostable enzyme used for PCR amplification of DNA. RNA was extracted from gibbon T-cells (MLA144), reverse transcribed and amplified with oligonucleotide primers (specific for the 5' portion of a spliced interleukin-2 (IL-2) messenger RNA) by Taq polymerase. A discrete fragment of correct length for IL-2 cDNA was detected. Experiments showed that this product was RNA-dependent and specific for IL-2. This fragment was sequenced by automation employing a biotin primer-streptavidin magnetic bead protocol which confirmed its origin as processed IL-2 mRNA. The modification of the RT-PCR procedure using a thermostable enzyme speeds up reaction time and increases stringency. This method should make the diagnostic screening of cells for gene expression more efficient and practical. AU - Rimstad E;Hornes E;Olsvik O;Hyllseth B; TI - Identification of a double-stranded RNA virus by using polymerase chain reaction and magnetic separation of the synthesized DNA segments. SO - J Clin Microbiol 1990 Oct;28(10):2275-8 JOURNAL OF CLINICAL MICROBIOLOGY (WASHINGTON) AB - A double-nested polymerase chain reaction assay (PCR), followed by magnetic separation of the PCR-synthesized DNA segments, was developed to detect a double-stranded RNA virus, infectious pancreatic necrosis virus from salmonid fish. Viral RNA was extracted from cell cultures and used for cDNA synthesis. The cDNA produced was used as a template in a double PCR. The sensitivity of this double PCR was approximately 0.8 pg of template double-stranded RNA. The DNA segment produced from the first PCR was also used as a template in a second PCR with a set of two 5'-labeled primers, one with biotin and the other with 32P. The PCR segment that was then synthesized was separated from the solution by using streptavidin-coated, superparamagnetic beads. The levels of radioactivity measured in the magnetically separated fractions were significantly higher in the positive samples than they were in the negative samples. AU - Wahlberg J;Lundeberg J;Hultman T;Holmberg M;Uhlen M; TI - Rapid detection and sequencing of specific in vitro amplified DNA sequences using solid phase methods. SO - Mol Cell Probes 1990 Aug;4(4):285-97 MOLECULAR AND CELLULAR PROBES (LONDON) AB - We describe a rapid solid phase assay for detection and sequencing of DNA sequences based on selective introduction of biotin and isotope into the specific DNA fragment amplified by the polymerase chain reaction (PCR). A two-step PCR procedure is used to lower the background signal. The in vitro amplified material is immobilized on magnetic beads with covalently coupled streptavidin and the amount of bound label is measured. Samples identified as positive can be analysed by direct solid phase DNA sequencing. A strategy is also described to use general primers for detection, capturing and sequencing, which are not homologous to the specific sequence to be detected. The concept has been optimized using oligonucleotides specific for Staphylococci and Streptococci, respectively. Here, we show that the assay can be used for detection of Plasmodium falciparum in clinical samples. AU - Hunsaker WR;Badri H;Lombardo M;Collins ML; TI - Nucleic acid hybridization assays employing dA-tailed capture probes. II. Advanced multiple capture methods. SO - Anal Biochem 1989 Sep;181(2):360-70 ANALYTICAL BIOCHEMISTRY (NEW YORK) AB - A fourth capture is added to the reversible target capture procedure of the preceding paper. This results in an improved radioisotopic detection limit of 7.3 x 10(-21) mol of target. In addition, the standard triple capture method is converted into a nonradioactive format with a detection limit of under 1 amol of target. The principal advantage of nonradioactive detection is that the entire assay can be performed in about 1 h. Nucleic acids are released from cells in the presence of the ('capture probe') which contains a 3'-poly(dA) sequence and the ('labeled probe') which contains a detectable nonradioactive moiety such as biotin. After a brief hybridization in solution, the target is captured on oligo(dT) magnetic particles. The target is further purified from sample impurities and excess labeled probe by recapture either once or twice more on fresh magnetic particles. The highly purified target is then concentrated to 200 nl by recapture onto a poly(dT) nitrocellulose filter and rapidly detected with streptavidin-alkaline phosphatase using bromochloroindolyl phosphate and nitroblue tetrazolium. Using this procedure, as little as 0.25 amol of a target plasmid has been detected nonradioactively in crude samples in just 1 h without prior purification of the DNA and RNA. Finally, a new procedure called background capture is introduced to complement the background-reducing power of RTC. AU - Hultman T;St ahl S;Hornes E;Uhlen M; TI - Direct solid phase sequencing of genomic and plasmid DNA using magnetic beads as solid support. SO - Nucleic Acids Res 1989 Jul 11;17(13):4937-46 NUCLEIC ACIDS RESEARCH (LONDON) AB - Approaches to direct solid phase sequencing of genomic and plasmid DNA have been developed using magnetic beads, coated with streptavidin, as solid support. The DNA is immobilized through selective incorporation of biotin into one of the strands. A single stranded template, suitable for sequencing, is obtained through strand-specific elution. Using this concept, in vitro amplified plasmid DNA and chromosomal DNA were sequenced directly from single colonies. The solid phase approach ensures that the amplification and the sequencing reactions can be performed under optimal conditions. The system was found to be suitable for sequencing using both isotope- and fluorescent-labelled primers. AU - Dudin G;Steegmayer EW;Vogt P;Schnitzer H;Diaz E;Howell KE;Cremer T; Cremer C; TI - Sorting of chromosomes by magnetic separation. SO - Hum Genet 1988 Oct;80(2):111-6 HUMAN GENETICS (BERLIN) AB - Chromosomes were isolated from Chinese hamster x human hybrid cell lines containing four and nine human chromosomes. Human genomic DNA was biotinylated by nick translation and used to label the human chromosomes by in situ hybridization in suspension. Streptavidin was covalently coupled to the surface of magnetic beads and these were incubated with the hybridized chromosomes. The human chromosomes were bound to the magnetic beads through the strong biotin-streptavidin complex and then rapidly separated from nonlabeled Chinese hamster chromosomes by a simple permanent magnet. The hybridization was visualized by additional binding of avidin-FITC (fluorescein) to the unoccupied biotinylated human DNA bound to the human chromosomes. After magnetic separation, up to 98% of the individual chromosomes attached to magnetic beads were classified as human chromosomes by fluorescence microscopy.