emboss EMBOSSDIR=/bio/mb/emboss/ EMBOSS_ACDROOT=/bio/mb/emboss/share/EMBOSS/acd PLPLOT_LIB=/bio/mb/emboss/share/EMBOSS empath=/bio/mb/emboss/bin/ PATH=/bio/mb/emboss/bin/:/usr/bin:/bin:/usr/sbin:/sbin:/usr/local/bin:/usr/local/sbin packinfo About/EMBOSS TITLE EMBOSS INFO About European Molecular Biology Open Source Suite (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/ version2.2.0 dateTue Feb 5 00:55:05 EST 2002 hostnamedghome abiview Display/abiview TITLE abiview (EMBOSS) INFO About Reads ABI file and display the trace (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/abiview.html fname Name of the ABI trace file -fname=$value outseq Output sequence output output biosequence/genbank abiview.out.gb -outseq=$value graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value separate Separate the trace graphs for the 4 bases false -separate yticks Display y-axis ticks false -yticks sequence Display the sequence on the graph true -nosequence window Sequence display window size 40 -window=$value bases Base graphs to be displayed GATC -bases=$value goutfile Output: graph output output image/pict abiview.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}abiview -auto $fname $outseq $graph $separate $yticks $sequence $window $bases $goutfile ajfeatest Test/ajfeatest TITLE ajfeatest (EMBOSS) INFO About Reads and writes (returns) a sequence and its features (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ajfeatest.html sequence Input sequences input input biosequence/genbank ajfeatest.in.gb -sequence=$value -sformat=genbank seqtype Sequence type any outseq Output sequence output output biosequence/genbank ajfeatest.out.gb -outseq=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ajfeatest -auto $sequence $outseq ajtest Test/ajtest TITLE ajtest (EMBOSS) INFO About Test file for ACD parsing (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ajtest.html sequence Input sequences input input biosequence/genbank ajtest.in.gb -sequence=$value -sformat=genbank seqset Input sequences input input biosequence/genbank ajtest.in.gb -seqset=$value -sformat=genbank STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ajtest -auto $sequence $seqset alignwrap alignment/global/alignwrap TITLE alignwrap (EMBOSS) INFO About Aligns a set of sequences to a seed alignment (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/alignwrap.html inpath inpath ./ -inpath=$value 0 Note Directory containing the seed alignments (input) extn extn .align -extn=$value 1 Note File extention of seed alignment files (input) scopfamilies scopfamilies -scopfamilies=$value 2 Note scop families file containing the set of sequences in EMBL-like format outpath outpath ./tmp/ -outpath=$value 3 Note Directory for extended alignments (output) outextn outextn .extalign -outextn=$value 4 Note File extention of extended alignment files (output) STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}alignwrap -auto $inpath $extn $scopfamilies $outpath $outextn antigenic Protein/Motifs/antigenic TITLE antigenic (EMBOSS) INFO About Finds antigenic sites in proteins (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/antigenic.html sequence Input sequences input input biosequence/genbank antigenic.in.gb -sequence=$value -sformat=genbank seqtype Sequence type PureProtein minlen Minimum length 6 -minlen=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}antigenic -auto $sequence $minlen backtranseq Nucleic/Translation/backtranseq Protein/Composition/backtranseq TITLE backtranseq (EMBOSS) INFO About Back translate a protein sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/backtranseq.html sequence Input sequences input input biosequence/genbank backtranseq.in.gb -sequence=$value -sformat=genbank seqtype Sequence type PureProtein cfile cfile [codon usage table name] Eacc.cut|Eadenovirus5.cut|Eadenovirus7.cut|Eaidlav.cut|Eanasp.cut|Eani.cut |Eanidmit.cut|Easn.cut|Eath.cut|Eatu.cut|Eavi.cut|Ebja.cut |Ebly.cut|Ebme.cut|Ebmo.cut|Ebna.cut|Ebov.cut|Ebovsp.cut |Ebst.cut|Ebsu.cut|Ecac.cut|Ecal.cut|Eccr.cut|Ecel.cut |Echi.cut|Echicken.cut|Echisp.cut|Echk.cut|Echmp.cut|Echnt.cut |Echos.cut|Echzm.cut|Echzmrubp.cut|Ecpx.cut|Ecre.cut|Ecrisp.cut |Ectr.cut|Edayhoff.cut|Eddi.cut|Edog.cut|Edro.cut|Edrosophila.cut |Eeca.cut|Eeco.cut|Eecoli.cut|Ef1.cut|Efish.cut|Efmdvpolyp.cut |Eham.cut|Ehha.cut|Ehin.cut|Ehma.cut|Ehum.cut|Ehuman.cut |Ekla.cut|Ekpn.cut|Ella.cut|Emac.cut|Emaize.cut|Emixlg.cut |Emouse.cut|Emsa.cut|Emse.cut|Emta.cut|Emtu.cut|Emus.cut |Emussp.cut|Emva.cut|Emze.cut|Emzecp.cut|Encr.cut|Eneu.cut |Engo.cut|Eoncsp.cut|Epae.cut|Epea.cut|Epet.cut|Epfa.cut |Ephix174.cut|Ephv.cut|Ephy.cut|Epig.cut|Epolyomaa2.cut|Epombe.cut |Epombecai.cut|Epot.cut|Eppu.cut|Epse.cut|Epsy.cut|Epvu.cut |Erab.cut|Erabbit.cut|Erabsp.cut|Erat.cut|Eratsp.cut|Erca.cut |Erhm.cut|Eric.cut|Erle.cut|Erme.cut|Ersp.cut|Esalsp.cut |Esau.cut|Esco.cut|Esgi.cut|Eshp.cut|Eshpsp.cut|Esli.cut |Eslm.cut|Esma.cut|Esmi.cut|Esmu.cut|Esoy.cut|Espi.cut |Espn.cut|Espo.cut|Espu.cut|Esta.cut|Esty.cut|Esus.cut |Esv40.cut|Esyhsp.cut|Esynsp.cut|Etbr.cut|Etcr.cut|Eter.cut |Etetsp.cut|Etob.cut|Etobcp.cut|Etom.cut|Etrb.cut|Evco.cut |Ewht.cut|Exel.cut|Exenopus.cut|Eyeast.cut|Eyeastcai.cut|Eyen.cut |Eysc.cut|Eyscmt.cut|Eysp.cut|Ezebrafish.cut|Ezma.cut -cfile=$value outfile Output sequence output output biosequence/genbank backtranseq.out.gb -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}backtranseq -auto $sequence $cfile $outfile banana Nucleic/Composition/banana TITLE banana (EMBOSS) INFO About Bending and curvature plot in B-DNA (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/banana.html sequence Input sequences input input biosequence/genbank banana.in.gb -sequence=$value -sformat=genbank seqtype Sequence type puredna anglesfile Input data input input text/plain banana.in -anglesfile=$value data Output as data false -data graph graph [device to be displayed on] png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value residuesperline Number of residues to be displayed on each line 50 -residuesperline=$value outfile Output output output text/plain banana.out -outfile=$value goutfile Output: graph output output image/pict banana.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}banana -auto $sequence $anglesfile $data $graph $residuesperline $outfile $goutfile biosed Sequence Edit/biosed TITLE biosed (EMBOSS) INFO About Replace or delete sequence sections (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/biosed.html sequence Input sequences input input biosequence/genbank biosed.in.gb -sequence=$value -sformat=genbank delete Delete the target sequence sections false -delete target Sequence section to match N -target=$value replace Replacement sequence section A -replace=$value outseq Output sequence output output biosequence/genbank biosed.out.gb -outseq=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}biosed -auto $sequence $delete $target $replace $outseq btwisted Nucleic/Composition/btwisted TITLE btwisted (EMBOSS) INFO About Calculates the twisting in a B-DNA sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/btwisted.html sequence Input sequences input input biosequence/genbank btwisted.in.gb -sequence=$value -sformat=genbank seqtype Sequence type PureDNA angledata File containing base pair twist angles Eangles.dat -angledata=$value energydata File containing base pair stacking energies Eenergy.dat -energydata=$value outfile Output output output text/plain btwisted.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}btwisted -auto $sequence $angledata $energydata $outfile cai Nucleic/Codon usage/cai TITLE cai (EMBOSS) INFO About CAI codon adaptation index (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/cai.html seqall Input sequences input input biosequence/genbank cai.in.gb -seqall=$value -sformat=genbank seqtype Sequence type DNA cfile Codon usage file Eacc.cut|Eadenovirus5.cut|Eadenovirus7.cut|Eaidlav.cut|Eanasp.cut|Eani.cut |Eanidmit.cut|Easn.cut|Eath.cut|Eatu.cut|Eavi.cut|Ebja.cut |Ebly.cut|Ebme.cut|Ebmo.cut|Ebna.cut|Ebov.cut|Ebovsp.cut |Ebst.cut|Ebsu.cut|Ecac.cut|Ecal.cut|Eccr.cut|Ecel.cut |Echi.cut|Echicken.cut|Echisp.cut|Echk.cut|Echmp.cut|Echnt.cut |Echos.cut|Echzm.cut|Echzmrubp.cut|Ecpx.cut|Ecre.cut|Ecrisp.cut |Ectr.cut|Edayhoff.cut|Eddi.cut|Edog.cut|Edro.cut|Edrosophila.cut |Eeca.cut|Eeco.cut|Eecoli.cut|Ef1.cut|Efish.cut|Efmdvpolyp.cut |Eham.cut|Ehha.cut|Ehin.cut|Ehma.cut|Ehum.cut|Ehuman.cut |Ekla.cut|Ekpn.cut|Ella.cut|Emac.cut|Emaize.cut|Emixlg.cut |Emouse.cut|Emsa.cut|Emse.cut|Emta.cut|Emtu.cut|Emus.cut |Emussp.cut|Emva.cut|Emze.cut|Emzecp.cut|Encr.cut|Eneu.cut |Engo.cut|Eoncsp.cut|Epae.cut|Epea.cut|Epet.cut|Epfa.cut |Ephix174.cut|Ephv.cut|Ephy.cut|Epig.cut|Epolyomaa2.cut|Epombe.cut |Epombecai.cut|Epot.cut|Eppu.cut|Epse.cut|Epsy.cut|Epvu.cut |Erab.cut|Erabbit.cut|Erabsp.cut|Erat.cut|Eratsp.cut|Erca.cut |Erhm.cut|Eric.cut|Erle.cut|Erme.cut|Ersp.cut|Esalsp.cut |Esau.cut|Esco.cut|Esgi.cut|Eshp.cut|Eshpsp.cut|Esli.cut |Eslm.cut|Esma.cut|Esmi.cut|Esmu.cut|Esoy.cut|Espi.cut |Espn.cut|Espo.cut|Espu.cut|Esta.cut|Esty.cut|Esus.cut |Esv40.cut|Esyhsp.cut|Esynsp.cut|Etbr.cut|Etcr.cut|Eter.cut |Etetsp.cut|Etob.cut|Etobcp.cut|Etom.cut|Etrb.cut|Evco.cut |Ewht.cut|Exel.cut|Exenopus.cut|Eyeast.cut|Eyeastcai.cut|Eyen.cut |Eysc.cut|Eyscmt.cut|Eysp.cut|Ezebrafish.cut|Ezma.cut -cfile=$value outfile Output output output text/plain cai.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}cai -auto $seqall $cfile $outfile chaos Nucleic/Composition/chaos TITLE chaos (EMBOSS) INFO About Create a chaos game representation plot for a sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/chaos.html sequence Input sequences input input biosequence/genbank chaos.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna data Display as data false -data graph graph [device to be displayed on] png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value outfile Output output output text/plain chaos.out -outfile=$value goutfile Output: graph output output image/pict chaos.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}chaos -auto $sequence $data $graph $outfile $goutfile charge Protein/Composition/charge TITLE charge (EMBOSS) INFO About Protein charge plot (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/charge.html seqall Input sequences input input biosequence/genbank charge.in.gb -seqall=$value -sformat=genbank seqtype Sequence type protein plot Produce graphic false -plot window Window 5 -window=$value graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value outfile Output output output text/plain charge.out -outfile=$value aadata Amino acid property data file name Eamino.dat -aadata=$value goutfile Output: graph output output image/pict charge.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}charge -auto $seqall $plot $window $graph $outfile $aadata $goutfile checktrans Protein/Composition/checktrans TITLE checktrans (EMBOSS) INFO About Reports STOP codons and ORF statistics of a protein sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/checktrans.html sequence Input sequences input input biosequence/genbank checktrans.in.gb -sequence=$value -sformat=genbank seqtype Sequence type stopprotein orfml Minimum ORF Length to report 100 -orfml=$value report Output output output text/plain checktrans.out -report=$value outseq Output sequence output output biosequence/genbank checktrans.out.gb -outseq=$value featout Output output output text/plain checktrans.out -featout=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}checktrans -auto $sequence $orfml $report $outseq $featout chips Nucleic/Codon usage/chips TITLE chips (EMBOSS) INFO About Codon usage statistics (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/chips.html seqall Input sequences input input biosequence/genbank chips.in.gb -seqall=$value -sformat=genbank seqtype Sequence type DNA cfile Codon usage file Eacc.cut|Eadenovirus5.cut|Eadenovirus7.cut|Eaidlav.cut|Eanasp.cut|Eani.cut |Eanidmit.cut|Easn.cut|Eath.cut|Eatu.cut|Eavi.cut|Ebja.cut |Ebly.cut|Ebme.cut|Ebmo.cut|Ebna.cut|Ebov.cut|Ebovsp.cut |Ebst.cut|Ebsu.cut|Ecac.cut|Ecal.cut|Eccr.cut|Ecel.cut |Echi.cut|Echicken.cut|Echisp.cut|Echk.cut|Echmp.cut|Echnt.cut |Echos.cut|Echzm.cut|Echzmrubp.cut|Ecpx.cut|Ecre.cut|Ecrisp.cut |Ectr.cut|Edayhoff.cut|Eddi.cut|Edog.cut|Edro.cut|Edrosophila.cut |Eeca.cut|Eeco.cut|Eecoli.cut|Ef1.cut|Efish.cut|Efmdvpolyp.cut |Eham.cut|Ehha.cut|Ehin.cut|Ehma.cut|Ehum.cut|Ehuman.cut |Ekla.cut|Ekpn.cut|Ella.cut|Emac.cut|Emaize.cut|Emixlg.cut |Emouse.cut|Emsa.cut|Emse.cut|Emta.cut|Emtu.cut|Emus.cut |Emussp.cut|Emva.cut|Emze.cut|Emzecp.cut|Encr.cut|Eneu.cut |Engo.cut|Eoncsp.cut|Epae.cut|Epea.cut|Epet.cut|Epfa.cut |Ephix174.cut|Ephv.cut|Ephy.cut|Epig.cut|Epolyomaa2.cut|Epombe.cut |Epombecai.cut|Epot.cut|Eppu.cut|Epse.cut|Epsy.cut|Epvu.cut |Erab.cut|Erabbit.cut|Erabsp.cut|Erat.cut|Eratsp.cut|Erca.cut |Erhm.cut|Eric.cut|Erle.cut|Erme.cut|Ersp.cut|Esalsp.cut |Esau.cut|Esco.cut|Esgi.cut|Eshp.cut|Eshpsp.cut|Esli.cut |Eslm.cut|Esma.cut|Esmi.cut|Esmu.cut|Esoy.cut|Espi.cut |Espn.cut|Espo.cut|Espu.cut|Esta.cut|Esty.cut|Esus.cut |Esv40.cut|Esyhsp.cut|Esynsp.cut|Etbr.cut|Etcr.cut|Eter.cut |Etetsp.cut|Etob.cut|Etobcp.cut|Etom.cut|Etrb.cut|Evco.cut |Ewht.cut|Exel.cut|Exenopus.cut|Eyeast.cut|Eyeastcai.cut|Eyen.cut |Eysc.cut|Eyscmt.cut|Eysp.cut|Ezebrafish.cut|Ezma.cut -cfile=$value window Averaging window 30 -window=$value outfile Output output output text/plain chips.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}chips -auto $seqall $cfile $window $outfile cirdna Display/cirdna TITLE cirdna (EMBOSS) INFO About Draws circular maps of DNA constructs (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/cirdna.html graphout graphout [device to be displayed on] png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graphout=$value inputfile Input data input input text/plain cirdna.in -inputfile=$value originangle position of the molecule's origin on the circle (enter a number in the range 0 - 360) 90 -originangle=$value posticks ticks inside or outside the circle (enter In or Out) Out -posticks=$value posblocks text inside or outside the blocks (enter In or Out) In -posblocks=$value intersymbol do you want horizontal junctions between blocks (Y or N) Y -intersymbol=$value intercolor color for junctions between blocks (enter a color number) 1 -intercolor=$value interticks do you want horizontal junctions between ticks (Y or N) N -interticks=$value gapsize interval between ticks in the ruler (enter an integer) 500 -gapsize=$value ticklines do you want vertical lines at the ruler's ticks (Y or N) N -ticklines=$value tickheight height of ticks (enter a number to multiply the default height) 1 -tickheight=$value blockheight height of blocks (enter a number to multiply the default height) 1 -blockheight=$value rangeheight height of range ends (enter a number to multiply the default height) 1 -rangeheight=$value gapgroup space between groups (enter a number to multiply the default space) 1 -gapgroup=$value postext space between text and ticks, blocks, and ranges (enter a number to multiply the default space) 1 -postext=$value goutfile Output: graphout output output image/pict cirdna.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}cirdna -auto $graphout $inputfile $originangle $posticks $posblocks $intersymbol $intercolor $interticks $gapsize $ticklines $tickheight $blockheight $rangeheight $gapgroup $postext $goutfile codcmp Nucleic/Codon usage/codcmp TITLE codcmp (EMBOSS) INFO About Codon usage table comparison (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/codcmp.html first First codon usage file Eacc.cut|Eadenovirus5.cut|Eadenovirus7.cut|Eaidlav.cut|Eanasp.cut|Eani.cut |Eanidmit.cut|Easn.cut|Eath.cut|Eatu.cut|Eavi.cut|Ebja.cut |Ebly.cut|Ebme.cut|Ebmo.cut|Ebna.cut|Ebov.cut|Ebovsp.cut |Ebst.cut|Ebsu.cut|Ecac.cut|Ecal.cut|Eccr.cut|Ecel.cut |Echi.cut|Echicken.cut|Echisp.cut|Echk.cut|Echmp.cut|Echnt.cut |Echos.cut|Echzm.cut|Echzmrubp.cut|Ecpx.cut|Ecre.cut|Ecrisp.cut |Ectr.cut|Edayhoff.cut|Eddi.cut|Edog.cut|Edro.cut|Edrosophila.cut |Eeca.cut|Eeco.cut|Eecoli.cut|Ef1.cut|Efish.cut|Efmdvpolyp.cut |Eham.cut|Ehha.cut|Ehin.cut|Ehma.cut|Ehum.cut|Ehuman.cut |Ekla.cut|Ekpn.cut|Ella.cut|Emac.cut|Emaize.cut|Emixlg.cut |Emouse.cut|Emsa.cut|Emse.cut|Emta.cut|Emtu.cut|Emus.cut |Emussp.cut|Emva.cut|Emze.cut|Emzecp.cut|Encr.cut|Eneu.cut |Engo.cut|Eoncsp.cut|Epae.cut|Epea.cut|Epet.cut|Epfa.cut |Ephix174.cut|Ephv.cut|Ephy.cut|Epig.cut|Epolyomaa2.cut|Epombe.cut |Epombecai.cut|Epot.cut|Eppu.cut|Epse.cut|Epsy.cut|Epvu.cut |Erab.cut|Erabbit.cut|Erabsp.cut|Erat.cut|Eratsp.cut|Erca.cut |Erhm.cut|Eric.cut|Erle.cut|Erme.cut|Ersp.cut|Esalsp.cut |Esau.cut|Esco.cut|Esgi.cut|Eshp.cut|Eshpsp.cut|Esli.cut |Eslm.cut|Esma.cut|Esmi.cut|Esmu.cut|Esoy.cut|Espi.cut |Espn.cut|Espo.cut|Espu.cut|Esta.cut|Esty.cut|Esus.cut |Esv40.cut|Esyhsp.cut|Esynsp.cut|Etbr.cut|Etcr.cut|Eter.cut |Etetsp.cut|Etob.cut|Etobcp.cut|Etom.cut|Etrb.cut|Evco.cut |Ewht.cut|Exel.cut|Exenopus.cut|Eyeast.cut|Eyeastcai.cut|Eyen.cut |Eysc.cut|Eyscmt.cut|Eysp.cut|Ezebrafish.cut|Ezma.cut -first=$value second Second codon usage file Eacc.cut|Eadenovirus5.cut|Eadenovirus7.cut|Eaidlav.cut|Eanasp.cut|Eani.cut |Eanidmit.cut|Easn.cut|Eath.cut|Eatu.cut|Eavi.cut|Ebja.cut |Ebly.cut|Ebme.cut|Ebmo.cut|Ebna.cut|Ebov.cut|Ebovsp.cut |Ebst.cut|Ebsu.cut|Ecac.cut|Ecal.cut|Eccr.cut|Ecel.cut |Echi.cut|Echicken.cut|Echisp.cut|Echk.cut|Echmp.cut|Echnt.cut |Echos.cut|Echzm.cut|Echzmrubp.cut|Ecpx.cut|Ecre.cut|Ecrisp.cut |Ectr.cut|Edayhoff.cut|Eddi.cut|Edog.cut|Edro.cut|Edrosophila.cut |Eeca.cut|Eeco.cut|Eecoli.cut|Ef1.cut|Efish.cut|Efmdvpolyp.cut |Eham.cut|Ehha.cut|Ehin.cut|Ehma.cut|Ehum.cut|Ehuman.cut |Ekla.cut|Ekpn.cut|Ella.cut|Emac.cut|Emaize.cut|Emixlg.cut |Emouse.cut|Emsa.cut|Emse.cut|Emta.cut|Emtu.cut|Emus.cut |Emussp.cut|Emva.cut|Emze.cut|Emzecp.cut|Encr.cut|Eneu.cut |Engo.cut|Eoncsp.cut|Epae.cut|Epea.cut|Epet.cut|Epfa.cut |Ephix174.cut|Ephv.cut|Ephy.cut|Epig.cut|Epolyomaa2.cut|Epombe.cut |Epombecai.cut|Epot.cut|Eppu.cut|Epse.cut|Epsy.cut|Epvu.cut |Erab.cut|Erabbit.cut|Erabsp.cut|Erat.cut|Eratsp.cut|Erca.cut |Erhm.cut|Eric.cut|Erle.cut|Erme.cut|Ersp.cut|Esalsp.cut |Esau.cut|Esco.cut|Esgi.cut|Eshp.cut|Eshpsp.cut|Esli.cut |Eslm.cut|Esma.cut|Esmi.cut|Esmu.cut|Esoy.cut|Espi.cut |Espn.cut|Espo.cut|Espu.cut|Esta.cut|Esty.cut|Esus.cut |Esv40.cut|Esyhsp.cut|Esynsp.cut|Etbr.cut|Etcr.cut|Eter.cut |Etetsp.cut|Etob.cut|Etobcp.cut|Etom.cut|Etrb.cut|Evco.cut |Ewht.cut|Exel.cut|Exenopus.cut|Eyeast.cut|Eyeastcai.cut|Eyen.cut |Eysc.cut|Eyscmt.cut|Eysp.cut|Ezebrafish.cut|Ezma.cut -second=$value outfile Output output output text/plain codcmp.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}codcmp -auto $first $second $outfile coderet Feature tables/coderet Nucleic/Translation/coderet TITLE coderet (EMBOSS) INFO About Extract CDS, mRNA and translations from feature tables (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/coderet.html seqall Input sequences input input biosequence/genbank coderet.in.gb -seqall=$value -sformat=genbank seqtype Sequence type DNA cds Extract CDS sequences true -nocds mrna Extract mrna sequences true -nomrna translation Extract translated sequences true -notranslation seqout Output sequence output output biosequence/genbank coderet.out.gb -seqout=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}coderet -auto $seqall $cds $mrna $translation $seqout complex Nucleic/Composition/complex TITLE complex (EMBOSS) INFO About Find the linguistic complexity in nucleotide sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/complex.html sequence Input sequences input input biosequence/genbank complex.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna omnia All sequences false -omnia 0 Note calculate over a set of sequences outseq Output sequence output output biosequence/genbank complex.out.gb -outseq=$value lwin Window length 100 -lwin=$value step Step size 5 -step=$value 1 Note the displacement of the window over the sequence sim Simulations 0 -sim=$value 2 Note calculate the linguistic complexity by comparison with a number of simulations having a uniform distribution of bases jmin Minimum word length 4 -jmin=$value 3 Note " jmax Maximum word length 6 -jmax=$value 4 Note " freq Calculate frequency false -freq 5 Note execute the simulation of a sequence based on the base frequency of the original sequence print Print to file false -print 6 Note generate a file named UjTable containing the values of Uj for each word j in the real sequence(s) and in any simulated sequences outfile Output output output text/plain complex.out -outfile=$value ujtable Output output output text/plain complex.out -ujtable=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}complex -auto $sequence $omnia $outseq $lwin $step $sim $jmin $jmax $freq $print $outfile $ujtable compseq Nucleic/Composition/compseq Protein/Composition/compseq TITLE compseq (EMBOSS) INFO About Counts the composition of dimer/trimer/etc words in a sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/compseq.html sequence Input sequences input input biosequence/genbank compseq.in.gb -sequence=$value -sformat=genbank word Word size to consider (e.g. 2=dimer) 2 -word=$value 0 Note This is the size of word (n-mer) to count. Thus if you want to count codon frequencies, you should enter 3 here. outfile Output output output text/plain compseq.out -outfile=$value infile Input data input input text/plain compseq.in -infile=$value zerocount Display the words that have a frequency of zero true -nozerocount 1 Note You can make the output results file much smaller if you do not display the words with a zero count. frame Frame of word to look at (0=all frames) 0 -frame=$value 2 Note The normal behaviour of 'compseq' is to count the frequencies of all words that occur by moving a window of length 'word' up by one each time. This option allows you to move the window up by the length of the word each time, skipping over the intervening words. You can count only those words that occur in a single frame of the word by setting this value to a number other than zero. If you set it to 1 it will only count the words in frame 1, 2 will only count the words in frame 2 and so on. ignorebz Ignore the amino acids B and Z and just count them as 'Other true -noignorebz 3 Note The amino acid code B represents Asparagine or Aspartic acid and the code Z represents Glutamine or Glutamic acid. These are not commonly used codes and you may wish not to count words containing them, just noting them in the count of 'Other' words. reverse Count words in the forward and reverse sense false -reverse 4 Note Set this to be true if you also wish to also count words in the reverse complement of a nucleic sequence. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}compseq -auto $sequence $word $outfile $infile $zerocount $frame $ignorebz $reverse cons Alignment/Consensus/cons TITLE cons (EMBOSS) INFO About Creates a consensus from multiple alignments (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/cons.html msf Input sequences input input biosequence/genbank cons.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany datafile Scoring matrix EDNAMAT -datafile=$value plurality Plurality check value -plurality=$value 0 Note Set a cut-off for the number of positive matches below which there is no consensus. The default plurality is taken as half the total weight of all the sequences in the alignment. setcase Define a threshold above which the consensus is given in uppercase 0 -setcase=$value 1 Note Sets the threshold for the positive matches above which the consensus is is upper-case and below which the consensus is in lower-case. identity Required number of identities at a position 0 -identity=$value 2 Note Provides the facility of setting the required number of identities at a site for it to give a consensus at that position. Therefore, if this is set to the number of sequences in the alignment only columns of identities contribute to the consensus. outseq Output sequence output output biosequence/genbank cons.out.gb -outseq=$value name Name of the consensus sequence -name=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}cons -auto $msf $datafile $plurality $setcase $identity $outseq $name contacts Protein/3D Structure/contacts TITLE contacts (EMBOSS) INFO About Reads coordinate files and writes contact files (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/contacts.html cpdb Location of coordinate files for input (embl-like format) ./ -cpdb=$value cpdbextn Extension of coordinate files (embl-like format) .pxyz -cpdbextn=$value con Location of contact files for output ./ -con=$value conextn Extension of contact files .con -conextn=$value thresh Threshold contact distance 1.0 -thresh=$value ignore Threshold ignore distance 20.0 -ignore=$value 0 Note If any two atoms from two different residues are at least this distance apart then no futher inter-atomic contacts will be checked for for that residue pair . This speeds the calculation up considerably. vdwf Name of data file with van der Waals radii Evdw.dat -vdwf=$value conerrf Output output output text/plain contacts.out -conerrf=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}contacts -auto $cpdb $cpdbextn $con $conextn $thresh $ignore $vdwf $conerrf corbatest Test/corbatest TITLE corbatest (EMBOSS) INFO About Test of EMBL corba retrieval (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/corbatest.html entry Enter an EMBL ID or ACCNO hsfau -entry=$value outfile Output output output text/plain corbatest.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}corbatest -auto $entry $outfile cpgplot Nucleic/CpG Islands/cpgplot TITLE cpgplot (EMBOSS) INFO About Plot CpG rich areas (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/cpgplot.html sequence Input sequences input input biosequence/genbank cpgplot.in.gb -sequence=$value -sformat=genbank seqtype Sequence type DNA window Window size 100 -window=$value 0 Note The percentage CG content and the Observed frequency of CG is calculated within a window whose size is set by this parameter. The window is moved down the sequence and these statistics are calculated at each postition that the window is moved to. shift Window shift increment 1 -shift=$value 1 Note This determines the number of bases that the window is moved each time after values of the percentage CG content and the Observed frequency of CG are calculated within the window. minlen Minimum length of an island 200 -minlen=$value 2 Note This sets the minimum length that a CpG island has to be before it is reported. minoe Minimum observed/expected 0.6 -minoe=$value 3 Note This sets the minimum average observed to expected ratio of C plus G to CpG in a set of 10 windows that are required before a CpG island is reported. minpc Minimum percentage 50. -minpc=$value 4 Note This sets the minimum average percentage of G plus C a set of 10 windows that are required before a CpG island is reported. outfile Output output output text/plain cpgplot.out -outfile=$value graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value obsexp Show observed/expected threshold line true -noobsexp 5 Note If this is set to true then the graph of the observed to expected ratio of C plus G to CpG within a window is displayed. cg Show CpG rich regions true -nocg 6 Note If this is set to true then the graph of the regions which have been determined to be CpG islands is displayed. pc Show percentage line true -nopc 7 Note If this is set to true then the graph of the percentage C plus G within a window is displayed. featout Output output output text/plain cpgplot.out -featout=$value goutfile Output: graph output output image/pict cpgplot.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}cpgplot -auto $sequence $window $shift $minlen $minoe $minpc $outfile $graph $obsexp $cg $pc $featout $goutfile cpgreport Nucleic/CpG Islands/cpgreport TITLE cpgreport (EMBOSS) INFO About Reports all CpG rich regions (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/cpgreport.html sequence Input sequences input input biosequence/genbank cpgreport.in.gb -sequence=$value -sformat=genbank seqtype Sequence type DNA score CpG score 17 -score=$value 0 Note This sets the score for each CG sequence found. A value of 17 is more sensitive, but 28 has also been used with some success. outfile Output output output text/plain cpgreport.out -outfile=$value featout Output output output text/plain cpgreport.out -featout=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}cpgreport -auto $sequence $score $outfile $featout cusp Nucleic/Codon usage/cusp TITLE cusp (EMBOSS) INFO About Create a codon usage table (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/cusp.html sequence Input sequences input input biosequence/genbank cusp.in.gb -sequence=$value -sformat=genbank seqtype Sequence type DNA cfile cfile [codon usage table name] Eacc.cut|Eadenovirus5.cut|Eadenovirus7.cut|Eaidlav.cut|Eanasp.cut|Eani.cut |Eanidmit.cut|Easn.cut|Eath.cut|Eatu.cut|Eavi.cut|Ebja.cut |Ebly.cut|Ebme.cut|Ebmo.cut|Ebna.cut|Ebov.cut|Ebovsp.cut |Ebst.cut|Ebsu.cut|Ecac.cut|Ecal.cut|Eccr.cut|Ecel.cut |Echi.cut|Echicken.cut|Echisp.cut|Echk.cut|Echmp.cut|Echnt.cut |Echos.cut|Echzm.cut|Echzmrubp.cut|Ecpx.cut|Ecre.cut|Ecrisp.cut |Ectr.cut|Edayhoff.cut|Eddi.cut|Edog.cut|Edro.cut|Edrosophila.cut |Eeca.cut|Eeco.cut|Eecoli.cut|Ef1.cut|Efish.cut|Efmdvpolyp.cut |Eham.cut|Ehha.cut|Ehin.cut|Ehma.cut|Ehum.cut|Ehuman.cut |Ekla.cut|Ekpn.cut|Ella.cut|Emac.cut|Emaize.cut|Emixlg.cut |Emouse.cut|Emsa.cut|Emse.cut|Emta.cut|Emtu.cut|Emus.cut |Emussp.cut|Emva.cut|Emze.cut|Emzecp.cut|Encr.cut|Eneu.cut |Engo.cut|Eoncsp.cut|Epae.cut|Epea.cut|Epet.cut|Epfa.cut |Ephix174.cut|Ephv.cut|Ephy.cut|Epig.cut|Epolyomaa2.cut|Epombe.cut |Epombecai.cut|Epot.cut|Eppu.cut|Epse.cut|Epsy.cut|Epvu.cut |Erab.cut|Erabbit.cut|Erabsp.cut|Erat.cut|Eratsp.cut|Erca.cut |Erhm.cut|Eric.cut|Erle.cut|Erme.cut|Ersp.cut|Esalsp.cut |Esau.cut|Esco.cut|Esgi.cut|Eshp.cut|Eshpsp.cut|Esli.cut |Eslm.cut|Esma.cut|Esmi.cut|Esmu.cut|Esoy.cut|Espi.cut |Espn.cut|Espo.cut|Espu.cut|Esta.cut|Esty.cut|Esus.cut |Esv40.cut|Esyhsp.cut|Esynsp.cut|Etbr.cut|Etcr.cut|Eter.cut |Etetsp.cut|Etob.cut|Etobcp.cut|Etom.cut|Etrb.cut|Evco.cut |Ewht.cut|Exel.cut|Exenopus.cut|Eyeast.cut|Eyeastcai.cut|Eyen.cut |Eysc.cut|Eyscmt.cut|Eysp.cut|Ezebrafish.cut|Ezma.cut -cfile=$value outfile Output output output text/plain cusp.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}cusp -auto $sequence $cfile $outfile cutgextract Utilities/Database creation/cutgextract TITLE cutgextract (EMBOSS) INFO About Extract data from CUTG (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/cutgextract.html wildspec Type of codon file *.codon -wildspec=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}cutgextract -auto $wildspec cutseq Sequence Edit/cutseq TITLE cutseq (EMBOSS) INFO About Removes a specified section from a sequence. (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/cutseq.html sequence Input sequences input input biosequence/genbank cutseq.in.gb -sequence=$value -sformat=genbank seqtype Sequence type gapany outseq Output sequence output output biosequence/genbank cutseq.out.gb -outseq=$value from Start of region to delete -from=$value 0 Note This is the start position (inclusive) of the section of the sequence that you wish to remove. to End of region to delete -to=$value 1 Note This is the end position (inclusive) of the section of the sequence that you wish to remove. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}cutseq -auto $sequence $outseq $from $to dan Nucleic/Composition/dan TITLE dan (EMBOSS) INFO About Calculates DNA RNA/DNA melting temperature (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/dan.html sequence Input sequences input input biosequence/genbank dan.in.gb -sequence=$value -sformat=genbank seqtype Sequence type DNA windowsize Enter window size 20 -windowsize=$value 0 Note The values of melting point and other thermodynamic properties of the sequence are determined by taking a short length of sequence known as a window and determining the properties of the sequence in that window. The window is incrementally moved along the sequence with the properties being calcualted at each new position. shiftincrement Enter Shift Increment 1 -shiftincrement=$value 1 Note This is the amount by which the window is moved at each increment in order to find the melting point and other properties along the sequence. dnaconc Enter DNA concentration (nM) 50. -dnaconc=$value saltconc Enter salt concentration (mM) 50. -saltconc=$value plot Produce a plot -plot 2 Note If this is not specified then the file of output data is produced, else a plot of the melting point along the sequence is produced. mintemp Enter minimum temperature 55. -mintemp=$value 3 Note Enter a minimum value for the temperature scale (y-axis) of the plot. graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value rna Use RNA data values -rna 4 Note This specifies that the sequence is an RNA sequnce and not a DNA sequence. product Prompt for product values -product 5 Note This prompts for percent formamide, percent of mismatches allowed and product length. formamide Enter percentage of formamide 0. -formamide=$value 6 Note This specifies the percent formamide to be used in calculations (it is ignored unless -product is used). mismatch Enter percent mismatch 0. -mismatch=$value 7 Note This specifies the percent mismatch to be used in calculations (it is ignored unless -product is used). prodlen Enter the product length -prodlen=$value 8 Note This specifies the product length to be used in calculations (it is ignored unless -product is used). thermo Thermodynamic calculations -thermo 9 Note Output the DeltaG, DeltaH and DeltaS values of the sequence windows to the output data file. temperature Enter temperature 25. -temperature=$value 10 Note If -thermo has been specified then this specifies the temperature at which to calculate the DeltaG, DeltaH and DeltaS values. goutfile Output: graph output output image/pict dan.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}dan -auto $sequence $windowsize $shiftincrement $dnaconc $saltconc $plot $mintemp $graph $rna $product $formamide $mismatch $prodlen $thermo $temperature $goutfile dbiblast Utilities/Database indexing/dbiblast TITLE dbiblast (EMBOSS) INFO About Index a BLAST database (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/dbiblast.html staden Use staden index file names -staden dbname Database name -dbname=$value directory Database directory . -directory=$value filename database base filename -filename=$value indexdirectory Index directory . -indexdirectory=$value sortoptions Sort option(s) -T.-k1,1 -sortoptions=$value 0 Note Sort options, typically '-T .' to use current directory for work files and '-k 1,1' to force GNU sort to use the first field release Release number 0.0 -release=$value date Index date 00/00/00 -date=$value 1 Note Allowed values: Date string dd/mm/yy systemsort Use system sort utility true -nosystemsort cleanup Clean up temporary files true -nocleanup seqtype Sequence type unknown -seqtype=$value blastversion Blast index version unknown -blastversion=$value sourcefile Use FASTA source file -sourcefile STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}dbiblast -auto $staden $dbname $directory $filename $indexdirectory $sortoptions $release $date $systemsort $cleanup $seqtype $blastversion $sourcefile dbifasta Utilities/Database indexing/dbifasta TITLE dbifasta (EMBOSS) INFO About Index a fasta database (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/dbifasta.html staden Use staden index file names -staden idformat ID line format idacc -idformat=$value dbname Database name -dbname=$value directory Database directory . -directory=$value filenames Wildcard database filename *.dat -filenames=$value exclude wildcard filename(s) to exclude -exclude=$value indexdirectory Index directory . -indexdirectory=$value sortoptions Sort option(s) -T.-k1,1 -sortoptions=$value 0 Note Sort options, typically '-T .' to use current directory for work files and '-k 1,1' to force GNU sort to use the first field release Release number 0.0 -release=$value date Index date 00/00/00 -date=$value 1 Note Allowed values: Date string dd/mm/yy systemsort Use system sort utility true -nosystemsort cleanup Clean up temporary files true -nocleanup STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}dbifasta -auto $staden $idformat $dbname $directory $filenames $exclude $indexdirectory $sortoptions $release $date $systemsort $cleanup dbiflat Utilities/Database indexing/dbiflat TITLE dbiflat (EMBOSS) INFO About Index a flat file database (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/dbiflat.html staden Use staden index file names -staden idformat Entry format SWISS -idformat=$value dbname Database name -dbname=$value directory Database directory . -directory=$value filenames Wildcard database filename *.dat -filenames=$value exclude wildcard filename(s) to exclude -exclude=$value indexdirectory Index directory . -indexdirectory=$value sortoptions Sort option(s) -T.-k1,1 -sortoptions=$value 0 Note Sort options, typically '-T .' to use current directory for work files and '-k 1,1' to force GNU sort to use the first field release Release number 0.0 -release=$value date Index date 00/00/00 -date=$value 1 Note Allowed values: Date string dd/mm/yy systemsort Use system sort utility true -nosystemsort cleanup Clean up temporary files true -nocleanup STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}dbiflat -auto $staden $idformat $dbname $directory $filenames $exclude $indexdirectory $sortoptions $release $date $systemsort $cleanup dbigcg Utilities/Database indexing/dbigcg TITLE dbigcg (EMBOSS) INFO About Index a GCG formatted database (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/dbigcg.html staden Use staden index file names -staden idformat Entry format EMBL -idformat=$value dbname Database name -dbname=$value directory Database directory . -directory=$value filename Wildcard database filename *.seq -filename=$value indexdirectory Index directory . -indexdirectory=$value sortoptions Sort option(s) -T.-k1,1 -sortoptions=$value 0 Note Sort options, typically '-T .' to use current directory for work files and '-k 1,1' to force GNU sort to use the first field release Release number 0.0 -release=$value date Index date 00/00/00 -date=$value 1 Note Allowed values: Date string dd/mm/yy systemsort Use system sort utility true -nosystemsort cleanup Clean up temporary files true -nocleanup STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}dbigcg -auto $staden $idformat $dbname $directory $filename $indexdirectory $sortoptions $release $date $systemsort $cleanup degapseq Sequence Edit/degapseq TITLE degapseq (EMBOSS) INFO About Removes gap characters from sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/degapseq.html sequence Input sequences input input biosequence/genbank degapseq.in.gb -sequence=$value -sformat=genbank seqtype Sequence type gapany outseq Output sequence output output biosequence/genbank degapseq.out.gb -outseq=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}degapseq -auto $sequence $outseq demoalign Test/demoalign TITLE demoalign (EMBOSS) INFO About Reads a sequence set, writes an alignment file (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/demoalign.html sequence Input sequences input input biosequence/genbank demoalign.in.gb -sequence=$value -sformat=genbank outfile outfile -outfile=$value floatmatrix floatmatrix EDNAMAT -floatmatrix=$value 0 Note Matrix file intmatrix intmatrix EDNAMAT -intmatrix=$value 1 Note Matrix file dofloat Use floating point matrix -dofloat STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}demoalign -auto $sequence $outfile $floatmatrix $intmatrix $dofloat demofeatures demo/demofeatures TITLE demofeatures (EMBOSS) INFO About demonstration of the feature functions (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/demofeatures.html featout Output output output text/plain demofeatures.out -featout=$value typesort Do you want to Sort by Type false -typesort 0 Note Sort output features by their type startsort Do you want to Sort by Start position false -startsort 1 Note Sort output features by their start position dictionary Read in the Gff Dictionary true -nodictionary 2 Note No will mean no checking of values tracedict Dump out the Dictionary at the end true -notracedict 3 Note Useful if you specify nodictionary as newly created one will be produced STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}demofeatures -auto $featout $typesort $startsort $dictionary $tracedict demolist Test/demolist TITLE demolist (EMBOSS) INFO About demonstration of the list functions (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/demolist.html gff Input data input input text/plain demolist.in -gff=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}demolist -auto $gff demoreport Test/demoreport TITLE demoreport (EMBOSS) INFO About Reads a sequence and feature table, writes a report (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/demoreport.html sequence Input sequences input input biosequence/genbank demoreport.in.gb -sequence=$value -sformat=genbank STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}demoreport -auto $sequence demosequence Test/demosequence TITLE demosequence (EMBOSS) INFO About demonstration of the sequence functions (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/demosequence.html STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}demosequence -auto $ demostring demo/demostring TITLE demostring (EMBOSS) INFO About demonstration of the string functions (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/demostring.html instring Value for instr -instring=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}demostring -auto $instring demotable demo/demotable TITLE demotable (EMBOSS) INFO About demonstration of the table functions (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/demotable.html gff Input data input input text/plain demotable.in -gff=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}demotable -auto $gff descseq Sequence Edit/descseq TITLE descseq (EMBOSS) INFO About Alter the name or description of a sequence. (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/descseq.html sequence Input sequences input input biosequence/genbank descseq.in.gb -sequence=$value -sformat=genbank seqtype Sequence type gapany outseq Output sequence output output biosequence/genbank descseq.out.gb -outseq=$value name Name of the sequence -name=$value description Description of the sequence -description=$value append Append to the existing description -append 0 Note This allows you to append the name or description you have given on to the end of the existing name or description of the sequence. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}descseq -auto $sequence $outseq $name $description $append dichet Protein/3D Structure/dichet TITLE dichet (EMBOSS) INFO About Parse dictionary of heterogen groups (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/dichet.html inf Input data input input text/plain dichet.in -inf=$value outf Output output output text/plain dichet.out -outf=$value dogrep Search a directory of files with keywords? false -dogrep path Directory to search with keywords ./ -path=$value extn Exension of files to search in above directory .ent -extn=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}dichet -auto $inf $outf $dogrep $path $extn diffseq Alignment/Differences/diffseq TITLE diffseq (EMBOSS) INFO About Find differences (SNPs) between nearly identical sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/diffseq.html asequence Input sequences input input biosequence/genbank diffseq.in.gb -asequence=$value -sformat=genbank seqtype Sequence type any bsequence Input sequences input input biosequence/genbank diffseq.in.gb -bsequence=$value -sformat=genbank seqtype Sequence type @($(asequence.protein) ? protein : nucleotide) wordsize Word size 10 -wordsize=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}diffseq -auto $asequence $bsequence $wordsize digest Protein/Motifs/digest TITLE digest (EMBOSS) INFO About Protein proteolytic enzyme or reagent cleavage digest (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/digest.html sequencea Input sequences input input biosequence/genbank digest.in.gb -sequencea=$value -sformat=genbank seqtype Sequence type Protein menu Select number -- Enzymes and Reagents 1 -menu=$value unfavoured Allow unfavoured cuts -unfavoured 0 Note Trypsin will not normally cut after a K if it is followed by (e.g.) another K or a P. Specifying this shows those cuts. as well as the favoured ones. overlap Show overlapping partials -overlap 1 Note Used for partial digestion. Shows all cuts from favoured cut sites plus 1..3, 2..4, 3..5 etc but not (e.g.) 2..5. Overlaps are therefore fragments with exactly one potential cut site within it. aadata Amino acid data file Eamino.dat -aadata=$value 2 Note Molecular weight data for amino acids allpartials Show all partials -allpartials 3 Note As for overlap but fragments containing more than one potential cut site are included. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}digest -auto $sequencea $menu $unfavoured $overlap $aadata $allpartials distmat Phylogeny/distmat TITLE distmat (EMBOSS) INFO About Creates a distance matrix from multiple alignments (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/distmat.html msf Input sequences input input biosequence/genbank distmat.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany nucmethod Method to use -- Multiple substitution correction methods for nucleotides 0 -nucmethod=$value 0 Note Multiple substitution correction methods for nucleotides. protmethod Method to use -- Multiple substitution correction methods for proteins 0 -protmethod=$value 1 Note Multiple substitution correction methods for proteins. outf Output output output text/plain distmat.out -outf=$value ambiguous Use the abiguous codes in the calculation. false -ambiguous 2 Note Option to use the abiguous codes in the calculation of the Jukes-Cantor method or if the sequences are proteins. gapweight Weight given to gaps 0. -gapweight=$value 3 Note Option to weight gaps in the uncorrected (nucleotide) and Jukes-Cantor distance methods. position Base position to analyse. 123 -position=$value 4 Note Choose base positions to analyse in each codon i.e. 123 (all bases), 12 (the first two bases), 1, 2, or 3 individual bases. calculatea Calculate the a-parameter false -calculatea 5 Note This will force the calculation of the a-parameter in the Jin-Nei Gamma distance calculation, otherwise the default is 1.0 (see -parametera option). parametera a-parameter 1.0 -parametera=$value 6 Note User defined a parameter to be use in the Jin-Nei Gamma distance calculation. The suggested value to be used is 1.0 [Jin et al.] and this is the default. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}distmat -auto $msf $nucmethod $protmethod $outf $ambiguous $gapweight $position $calculatea $parametera domainer Utilities/Database creation/domainer TITLE domainer (EMBOSS) INFO About Build domain coordinate files (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/domainer.html scop Input data input input text/plain domainer.in -scop=$value cpdb Location of coordinate files for input (embl-like format) ./ -cpdb=$value cpdbscop Location of coordinate files for output (embl-like format) ./ -cpdbscop=$value cpdbextn Extension of coordinate files (embl-like format) .pxyz -cpdbextn=$value pdbscop Location of coordinate files for output (pdb format) ./ -pdbscop=$value pdbextn Extension of coordinate files (pdb format) .ent -pdbextn=$value cpdberrf Output output output text/plain domainer.out -cpdberrf=$value pdberrf Output output output text/plain domainer.out -pdberrf=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}domainer -auto $scop $cpdb $cpdbscop $cpdbextn $pdbscop $pdbextn $cpdberrf $pdberrf dotmatcher Alignment/Dot plots/dotmatcher TITLE dotmatcher (EMBOSS) INFO About Displays a thresholded dotplot of two sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/dotmatcher.html sequencea Input sequences input input biosequence/genbank dotmatcher.in.gb -sequencea=$value -sformat=genbank seqtype Sequence type any sequenceb Input sequences input input biosequence/genbank dotmatcher.in.gb -sequenceb=$value -sformat=genbank seqtype Sequence type @($(sequencea.protein) ? protein : nucleotide) windowsize window size over which to test threshhold 10 -windowsize=$value threshold threshold 17 -threshold=$value matrixfile Matrix file EDNAMAT -matrixfile=$value data Display as data false -data 0 Note Output the match data to a file instead of plotting it graph graph [device to be displayed on] png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value outfile Output output output text/plain dotmatcher.out -outfile=$value goutfile Output: graph output output image/pict dotmatcher.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}dotmatcher -auto $sequencea $sequenceb $windowsize $threshold $matrixfile $data $graph $outfile $goutfile dotpath Alignment/Dot plots/dotpath TITLE dotpath (EMBOSS) INFO About Displays a non-overlapping wordmatch dotplot of two sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/dotpath.html sequencea Input sequences input input biosequence/genbank dotpath.in.gb -sequencea=$value -sformat=genbank seqtype Sequence type any sequenceb Input sequences input input biosequence/genbank dotpath.in.gb -sequenceb=$value -sformat=genbank seqtype Sequence type @($(sequencea.protein) ? protein : nucleotide) wordsize Word size 4 -wordsize=$value overlaps Display the overlapping matches false -overlaps 0 Note Displays the overlapping matches (in red) as well as the minimal set of non-overlapping matches data Display as data false -data 1 Note Output the match data to a file instead of plotting it graph graph [device to be displayed on] png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value boxit Draw a box around dotplot true -noboxit outfile Output output output text/plain dotpath.out -outfile=$value goutfile Output: graph output output image/pict dotpath.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}dotpath -auto $sequencea $sequenceb $wordsize $overlaps $data $graph $boxit $outfile $goutfile dottup Alignment/Dot plots/dottup TITLE dottup (EMBOSS) INFO About Displays a wordmatch dotplot of two sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/dottup.html sequencea Input sequences input input biosequence/genbank dottup.in.gb -sequencea=$value -sformat=genbank seqtype Sequence type any sequenceb Input sequences input input biosequence/genbank dottup.in.gb -sequenceb=$value -sformat=genbank seqtype Sequence type @($(sequencea.protein) ? protein : nucleotide) wordsize Word size 4 -wordsize=$value data Display as data false -data 0 Note Output the match data to a file instead of plotting it graph graph [device to be displayed on] png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value boxit Draw a box around dotplot true -noboxit outfile Output output output text/plain dottup.out -outfile=$value goutfile Output: graph output output image/pict dottup.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}dottup -auto $sequencea $sequenceb $wordsize $data $graph $boxit $outfile $goutfile dreg Nucleic/Motifs/dreg TITLE dreg (EMBOSS) INFO About regular expression search of a nucleotide sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/dreg.html sequence Input sequences input input biosequence/genbank dreg.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna outfile Output output output text/plain dreg.out -outfile=$value pattern Regular expression pattern -pattern=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}dreg -auto $sequence $outfile $pattern ealistat HMM/ealistat TITLE ealistat (EMBOSS) INFO About Statistics for multiple alignment files (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ealistat.html infile Input data input input text/plain ealistat.in -infile=$value additional Show additional information false -additional fast Use sampling method false -fast outfile Output output output text/plain ealistat.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ealistat -auto $infile $additional $fast $outfile eclique phylip/eclique TITLE eclique (EMBOSS) INFO About Largest clique program (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/eclique.html infile Input data input input text/plain eclique.in -infile=$value outfile Output output output text/plain eclique.out -outfile=$value trout Create a tree file true -notrout drawtree Draw tree true -nodrawtree treefile Output output output text/plain eclique.out -treefile=$value ancestral Use ancestral states in input file false -ancestral minclique Use minimum clique size false -minclique cliqminnum Minimum clique size 1 -cliqminnum=$value og Outgroup root false -og outgnum number of the outgroup 1 -outgnum=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress matrixout Print out compatibility matrix false -matrixout STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}eclique -auto $infile $outfile $trout $drawtree $treefile $ancestral $minclique $cliqminnum $og $outgnum $printdata $progress $matrixout econsense phylip/econsense TITLE econsense (EMBOSS) INFO About Majority-rule and strict consensus tree (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/econsense.html infile Input data input input text/plain econsense.in -infile=$value outfile Output output output text/plain econsense.out -outfile=$value trout Create a tree file true -notrout drawtree Draw tree true -nodrawtree treefile Output output output text/plain econsense.out -treefile=$value root Trees to be treated as Rooted false -root og Outgroup root false -og outgnum number of the outgroup 1 -outgnum=$value progress Print indications of progress of run false -progress printsets Print out the sets of species true -noprintsets STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}econsense -auto $infile $outfile $trout $drawtree $treefile $root $og $outgnum $progress $printsets econtml phylip/econtml TITLE econtml (EMBOSS) INFO About Continuous character Maximum Likelihood method (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/econtml.html infile Input data input input text/plain econtml.in -infile=$value outfile Output output output text/plain econtml.out -outfile=$value besttree Search for best tree true -nobesttree lengths Use lengths from user trees false -lengths global Global rearrangements false -global random Randomize input order of species false -random randseed Random number seed (must be odd) 3 -randseed=$value continuous continuous characters (else Gene frequencies) false -continuous all Input file has all alleles at each locus false -all og Outgroup root false -og outgnum number of the outgroup 1 -outgnum=$value multsets Analyze multiple data sets false -multsets datasets How many data sets 1 -datasets=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress drawtree Draw tree true -nodrawtree trout Create a tree file true -notrout treefile Output output output text/plain econtml.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}econtml -auto $infile $outfile $besttree $lengths $global $random $randseed $continuous $all $og $outgnum $multsets $datasets $printdata $progress $drawtree $trout $treefile econtrast phylip/econtrast TITLE econtrast (EMBOSS) INFO About Continuous character Contrasts (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/econtrast.html infile Input data input input text/plain econtrast.in -infile=$value treefile Input data input input text/plain econtrast.in -treefile=$value outfile Output output output text/plain econtrast.out -outfile=$value corplusreg Print out correlations and regressions true -nocorplusreg multsets Analyze multiple data sets false -multsets datasets How many data sets 1 -datasets=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}econtrast -auto $infile $treefile $outfile $corplusreg $multsets $datasets $printdata $progress ednacomp phylip/ednacomp TITLE ednacomp (EMBOSS) INFO About DNA compatibility algorithm (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ednacomp.html msf Input sequences input input biosequence/genbank ednacomp.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany outfile Output output output text/plain ednacomp.out -outfile=$value trout Create a tree file true -notrout drawtree Draw tree true -nodrawtree treefile Output output output text/plain ednacomp.out -treefile=$value og Outgroup root false -og outgnum number of the outgroup 1 -outgnum=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress stepoutput Print steps & compatibility at sites false -stepoutput allnodes Print sequences at all nodes of tree false -allnodes random Randomize input order of species false -random randseed Random number seed (must be odd) -randseed=$value randtimes Number of times to jumble -randtimes=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ednacomp -auto $msf $outfile $trout $drawtree $treefile $og $outgnum $printdata $progress $stepoutput $allnodes $random $randseed $randtimes ednadist phylip/ednadist TITLE ednadist (EMBOSS) INFO About Nucleic acid sequence Distance Matrix program (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ednadist.html msf Input sequences input input biosequence/genbank ednadist.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany outfile Output output output text/plain ednadist.out -outfile=$value method Choose the method to use -- Distance methods Kimura -method=$value ttratio Transition/transversion ratio 2.0 -ttratio=$value categories Number of categories of substitution rates 1 -categories=$value basefrequency Use empirical base frequencies true -nobasefrequency printinitial Print out the data at start of run false -printinitial freqa Frequency for A 0.25 -freqa=$value freqc Frequency for C 0.25 -freqc=$value freqg Frequency for G 0.25 -freqg=$value freqt Frequency for T/U 0.25 -freqt=$value matrix Form -- Form of distance matrix S -matrix=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ednadist -auto $msf $outfile $method $ttratio $categories $basefrequency $printinitial $freqa $freqc $freqg $freqt $matrix ednainvar phylip/ednainvar TITLE ednainvar (EMBOSS) INFO About Nucleic acid sequence Invariants method (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ednainvar.html msf Input sequences input input biosequence/genbank ednainvar.in.gb -msf=$value -sformat=genbank outfile Output output output text/plain ednainvar.out -outfile=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ednainvar -auto $msf $outfile $printdata $progress ednaml phylip/ednaml TITLE ednaml (EMBOSS) INFO About Estimates phylogenies from nucleic acid sequence Maximum Likelihood (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ednaml.html msf Input sequences input input biosequence/genbank ednaml.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany outfile Output output output text/plain ednaml.out -outfile=$value besttree Search for best tree true -nobesttree lengths Use lengths from user trees false -lengths global Global rearrangements false -global random Randomize input order of species false -random randseed Random number seed (must be odd) 3 -randseed=$value randtimes How many times to randomise 3 -randtimes=$value ttratio Transition/transversion ratio 2.0 -ttratio=$value basefrequency Use empirical base frequencies true -nobasefrequency freqa Frequency for A 0.25 -freqa=$value freqc Frequency for C 0.25 -freqc=$value freqg Frequency for G 0.25 -freqg=$value freqt Frequency for T/U 0.25 -freqt=$value categories More then one category of substitution rates false -categories catnum Number of categories of substitution rates 2 -catnum=$value catvals space seperated category values -catvals=$value catprob space seperated probabillity values -catprob=$value autog Use Defualt Mean block length of sites false -autog lambda Mean block length of sites having the same rate (greater than 1) 1.0 -lambda=$value og Outgroup root false -og outgnum number of the outgroup 1 -outgnum=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress drawtree Draw tree true -nodrawtree trout Create a tree file true -notrout treefile Output output output text/plain ednaml.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ednaml -auto $msf $outfile $besttree $lengths $global $random $randseed $randtimes $ttratio $basefrequency $freqa $freqc $freqg $freqt $categories $catnum $catvals $catprob $autog $lambda $og $outgnum $printdata $progress $drawtree $trout $treefile ednamlk phylip/ednamlk TITLE ednamlk (EMBOSS) INFO About Estimates phylogenies from nucleic acid sequence Maximum Likelihood with molecular clock (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ednamlk.html msf Input sequences input input biosequence/genbank ednamlk.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany outfile Output output output text/plain ednamlk.out -outfile=$value besttree Search for best tree true -nobesttree lengths Use lengths from user trees false -lengths global Global rearrangements false -global random Randomize input order of species false -random randseed Random number seed (must be odd) 3 -randseed=$value randtimes How many times to randomise 3 -randtimes=$value ttratio Transition/transversion ratio 2.0 -ttratio=$value basefrequency Use empirical base frequencies true -nobasefrequency freqa Frequency for A 0.25 -freqa=$value freqc Frequency for C 0.25 -freqc=$value freqg Frequency for G 0.25 -freqg=$value freqt Frequency for T/U 0.25 -freqt=$value categories More than one category of substitution rates false -categories catnum Number of categories of substitution rates 2 -catnum=$value catvals space seperated category values -catvals=$value catprob space seperated probabillity values -catprob=$value autog Use Defualt Mean block length of sites false -autog lambda Mean block length of sites having the same rate (greater than 1) 1.0 -lambda=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress drawtree Draw tree true -nodrawtree trout Create a tree file true -notrout treefile Output output output text/plain ednamlk.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ednamlk -auto $msf $outfile $besttree $lengths $global $random $randseed $randtimes $ttratio $basefrequency $freqa $freqc $freqg $freqt $categories $catnum $catvals $catprob $autog $lambda $printdata $progress $drawtree $trout $treefile ednapars phylip/ednapars TITLE ednapars (EMBOSS) INFO About DNA parsimony algorithm (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ednapars.html msf Input sequences input input biosequence/genbank ednapars.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany outfile Output output output text/plain ednapars.out -outfile=$value besttree Search for best tree true -nobesttree random Randomize input order of species false -random randseed Random number seed (must be odd) 3 -randseed=$value randtimes How many times to randomise 3 -randtimes=$value og Outgroup root false -og outgnum number of the outgroup 1 -outgnum=$value thresh Use Threshold parsimony false -thresh valthresh threshold value 1.0 -valthresh=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress steps Print out steps in each site false -steps seqatnodes Print sequences at all nodes of tree false -seqatnodes drawtree Draw tree true -nodrawtree trout Create a tree file true -notrout treefile Output output output text/plain ednapars.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ednapars -auto $msf $outfile $besttree $random $randseed $randtimes $og $outgnum $thresh $valthresh $printdata $progress $steps $seqatnodes $drawtree $trout $treefile ednapenny phylip/ednapenny TITLE ednapenny (EMBOSS) INFO About Penny algorithm for DNA (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ednapenny.html msf Input sequences input input biosequence/genbank ednapenny.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany outfile Output output output text/plain ednapenny.out -outfile=$value numgroups How many groups of 100 trees 1000 -numgroups=$value howoften How often to report, in trees 100 -howoften=$value simple Branch and bound is simple -simple og Outgroup root false -og outgnum number of the outgroup 1 -outgnum=$value thresh Use Threshold parsimony false -thresh valthresh threshold value 1.0 -valthresh=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress steps Print out steps in each site false -steps seqatnodes Print sequences at all nodes of tree false -seqatnodes drawtree Draw tree true -nodrawtree trout Create a tree file true -notrout treefile Output output output text/plain ednapenny.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ednapenny -auto $msf $outfile $numgroups $howoften $simple $og $outgnum $thresh $valthresh $printdata $progress $steps $seqatnodes $drawtree $trout $treefile edollop phylip/edollop TITLE edollop (EMBOSS) INFO About Dollo and polymorphism parsimony algorithm (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/edollop.html datafile Input data input input text/plain edollop.in -datafile=$value outfile Output output output text/plain edollop.out -outfile=$value besttree Search for best tree true -nobesttree random Randomize input order of species false -random randseed Random number seed (must be odd) 3 -randseed=$value randtimes How many times to randomise 3 -randtimes=$value dollo Do Dollo (else Polymorphism) true -nodollo thresh Use Threshold parsimony false -thresh valthresh threshold value 1.0 -valthresh=$value ancest Use ancestral states in input file false -ancest multsets Analyze multiple data sets false -multsets datasets number of sets 2 -datasets=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress steps Print out steps in each site false -steps statesatnodes Print states at all nodes of tree false -statesatnodes drawtree Draw tree true -nodrawtree trout Create a tree file true -notrout treefile Output output output text/plain edollop.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}edollop -auto $datafile $outfile $besttree $random $randseed $randtimes $dollo $thresh $valthresh $ancest $multsets $datasets $printdata $progress $steps $statesatnodes $drawtree $trout $treefile edolpenny phylip/edolpenny TITLE edolpenny (EMBOSS) INFO About Penny algorithm Dollo or polymorphism (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/edolpenny.html datafile Input data input input text/plain edolpenny.in -datafile=$value outfile Output output output text/plain edolpenny.out -outfile=$value dollo Dollo Parsimony method (else Polymorphis) true -nodollo numgroups How many groups of 100 trees 1000 -numgroups=$value howoften How often to report, in trees 100 -howoften=$value simple Branch and bound is simple -simple thresh Use Threshold parsimony false -thresh valthresh threshold value 1.0 -valthresh=$value ancest Use ancestral states in input file false -ancest multsets Analyze multiple data sets false -multsets datasets number of sets 2 -datasets=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress steps Print out steps in each site false -steps statesatnodes Print states at all nodes of tree false -statesatnodes drawtree Draw tree true -nodrawtree trout Create a tree file true -notrout treefile Output output output text/plain edolpenny.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}edolpenny -auto $datafile $outfile $dollo $numgroups $howoften $simple $thresh $valthresh $ancest $multsets $datasets $printdata $progress $steps $statesatnodes $drawtree $trout $treefile efactor phylip/efactor TITLE efactor (EMBOSS) INFO About multistate to binary recoding program (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/efactor.html datafile Input data input input text/plain efactor.in -datafile=$value outfile Output output output text/plain efactor.out -outfile=$value anc put ancestral states in output file false -anc factors put factors information in output file false -factors progress show progress true -noprogress STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}efactor -auto $datafile $outfile $anc $factors $progress efitch phylip/efitch TITLE efitch (EMBOSS) INFO About Fitch-Margoliash and Least-Squares Distance Methods (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/efitch.html infile Input data input input text/plain efitch.in -infile=$value outfile Output output output text/plain efitch.out -outfile=$value besttree Search for best tree true -nobesttree length Use lengths from user trees false -length power Power 3.0 -power=$value negbranch Negative branch lengths allowed false -negbranch random Randomize input order of species false -random randseed Random number seed (must be odd) -randseed=$value randtimes Number of times to jumble -randtimes=$value global Global rearrangements false -global og Outgroup root false -og outgnum number of the outgroup 1 -outgnum=$value lt Lower-triangular data matrix false -lt ut Upper-triangular data matrix false -ut replicates Subreplicates false -replicates multsets Analyze multiple data sets false -multsets datasets How many data sets -datasets=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress trout Create a tree file true -notrout drawtree Draw tree true -nodrawtree treefile Output output output text/plain efitch.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}efitch -auto $infile $outfile $besttree $length $power $negbranch $random $randseed $randtimes $global $og $outgnum $lt $ut $replicates $multsets $datasets $printdata $progress $trout $drawtree $treefile egendist phylip/egendist TITLE egendist (EMBOSS) INFO About Genetic Distance Matrix program (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/egendist.html infile Input data input input text/plain egendist.in -infile=$value outfile Output output output text/plain egendist.out -outfile=$value all Input file contains all alleles at each locus (else one) false -all STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}egendist -auto $infile $outfile $all ehmmalign HMM/ehmmalign TITLE ehmmalign (EMBOSS) INFO About Align sequences with an HMM (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ehmmalign.html hmmfile Input data input input text/plain ehmmalign.in -hmmfile=$value sequences Input sequences input input biosequence/genbank ehmmalign.in.gb -sequences=$value -sformat=genbank mapali Map alignment -mapali=$value withali Heuristic alignment -withali=$value matchonly Only show match state alignment symbols false -matchonly outfile Output output output text/plain ehmmalign.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ehmmalign -auto $hmmfile $sequences $mapali $withali $matchonly $outfile ehmmbuild HMM/ehmmbuild TITLE ehmmbuild (EMBOSS) INFO About Build HMM (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ehmmbuild.html sequences Input sequences input input biosequence/genbank ehmmbuild.in.gb -sequences=$value -sformat=genbank strategy Select preference -- Local/Global preference L -strategy=$value name Name for the HMM Ehmm -name=$value resave Resave selex file -resave=$value append Append to file false -append force Force overwriting false -force amino Treat as protein false -amino nucleic Treat as dna false -nucleic archpri Architecture prior 0.85 -archpri=$value binary Write HMM as binary false -binary cfile Emission and transition count file -cfile=$value cstrategy Select strategy -- Fast or by hand F -cstrategy=$value fast Work in fast mode false -fast gapmax Fast mode control 0.5 -gapmax=$value hand specify model by hand false -hand idlevel Cutoff ID threhold 0.62 -idlevel=$value efficiency Be efficient true -noefficiency null NULL model file -null=$value pam PAM file -pam=$value pamweight Weighting for PAM 20.0 -pamweight=$value prior Prior file -prior=$value swentry Probability control for local entries 0.5 -swentry=$value swexit Probability control for exits 0.5 -swexit=$value more Verbosity false -more weighting Select weighting -- Weighting method G -weighting=$value outfile Output output output text/plain ehmmbuild.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ehmmbuild -auto $sequences $strategy $name $resave $append $force $amino $nucleic $archpri $binary $cfile $cstrategy $fast $gapmax $hand $idlevel $efficiency $null $pam $pamweight $prior $swentry $swexit $more $weighting $outfile ehmmcalibrate HMM/ehmmcalibrate TITLE ehmmcalibrate (EMBOSS) INFO About Calibrate a hidden Markov model (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ehmmcalibrate.html infile Input data input input text/plain ehmmcalibrate.in -infile=$value cpu Number of CPUs 0 -cpu=$value fixed Length fix for random sequences 0 -fixed=$value histogram Name for histogram file -histogram=$value mean Mean length of synthetic sequences 350. -mean=$value num Number of synthetic sequences 5000 -num=$value pvm Run on parallel virtual machines false -pvm sd Standard deviation of syntheic sequences 350. -sd=$value seed Random seed 0 -seed=$value outfile Output output output text/plain ehmmcalibrate.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ehmmcalibrate -auto $infile $cpu $fixed $histogram $mean $num $pvm $sd $seed $outfile ehmmconvert HMM/ehmmconvert TITLE ehmmconvert (EMBOSS) INFO About Convert between HMM formats (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ehmmconvert.html infile Input data input input text/plain ehmmconvert.in -infile=$value format Select format -- HMM format A -format=$value append Append to file false -append force Force overwriting false -force outfile Output output output text/plain ehmmconvert.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ehmmconvert -auto $infile $format $append $force $outfile ehmmemit HMM/ehmmemit TITLE ehmmemit (EMBOSS) INFO About Extract HMM sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ehmmemit.html infile Input data input input text/plain ehmmemit.in -infile=$value selex Output in selex format false -selex consensus Output consensus sequence false -consensus number Number of sequences to produce 10 -number=$value seed Random seed 0 -seed=$value outfile Output output output text/plain ehmmemit.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ehmmemit -auto $infile $selex $consensus $number $seed $outfile ehmmfetch HMM/ehmmfetch TITLE ehmmfetch (EMBOSS) INFO About Extract HMM from a database (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ehmmfetch.html database Database name -database=$value consensus Entry name -consensus=$value outfile Output output output text/plain ehmmfetch.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ehmmfetch -auto $database $consensus $outfile ehmmindex HMM/ehmmindex TITLE ehmmindex (EMBOSS) INFO About Index an HMM database (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ehmmindex.html infile Input data input input text/plain ehmmindex.in -infile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ehmmindex -auto $infile ehmmpfam HMM/ehmmpfam TITLE ehmmpfam (EMBOSS) INFO About Align single sequence with an HMM (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ehmmpfam.html sequences Input sequences input input biosequence/genbank ehmmpfam.in.gb -sequences=$value -sformat=genbank hmmfile HMM file -hmmfile=$value nucleic Force nucleic comparison false -nucleic nalign Number of alignments 100 -nalign=$value evalue E-value cutoff 10. -evalue=$value hitcut Hit score cutoff -1000000. -hitcut=$value dbsize Calc E-value for DB size n 59021 -dbsize=$value cpu Number of CPUs 0 -cpu=$value dome E-value domain cutoff 1000000. -dome=$value domt Hit score domain cutoff -1000000. -domt=$value forward Use forward algorithm false -forward nulltwo Turn off second null model false -nulltwo pvm Use parallel virtual machine false -pvm xnu Use XNU filtering false -xnu outfile Output output output text/plain ehmmpfam.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ehmmpfam -auto $sequences $hmmfile $nucleic $nalign $evalue $hitcut $dbsize $cpu $dome $domt $forward $nulltwo $pvm $xnu $outfile ehmmsearch HMM/ehmmsearch TITLE ehmmsearch (EMBOSS) INFO About Search sequence database with an HMM (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ehmmsearch.html sequences Input sequences input input biosequence/genbank ehmmsearch.in.gb -sequences=$value -sformat=genbank hmmfile HMM file -hmmfile=$value nalign Number of alignments 100 -nalign=$value evalue E-value cutoff 10. -evalue=$value hitcut Hit score cutoff -1000000. -hitcut=$value dbsize Calc E-value for DB size n 59021 -dbsize=$value cpu Number of CPUs 0 -cpu=$value dome E-value domain cutoff 1000000. -dome=$value domt Hit score domain cutoff -1000000. -domt=$value forward Use forward algorithm false -forward nulltwo Turn off second null model false -nulltwo pvm Use parallel virtual machine false -pvm xnu Use XNU filtering false -xnu outfile Output output output text/plain ehmmsearch.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ehmmsearch -auto $sequences $hmmfile $nalign $evalue $hitcut $dbsize $cpu $dome $domt $forward $nulltwo $pvm $xnu $outfile einverted Nucleic/Repeats/einverted Nucleic/2D structure/einverted TITLE einverted (EMBOSS) INFO About Finds DNA inverted repeats (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/einverted.html sequence Input sequences input input biosequence/genbank einverted.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna outfile Output output output text/plain einverted.out -outfile=$value gap Gap penalty 12 -gap=$value threshold Minimum score threshold 50 -threshold=$value match Match score 3 -match=$value mismatch Mismatch score -4 -mismatch=$value maxrepeat Maximum extent of repeats 4000 -maxrepeat=$value 0 Note Maximum separation between the start of repeat and the end of the inverted repeat (the default is 4000 bases). STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}einverted -auto $sequence $outfile $gap $threshold $match $mismatch $maxrepeat ekitsch phylip/ekitsch TITLE ekitsch (EMBOSS) INFO About Fitch-Margoliash method with contemporary tips (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/ekitsch.html infile Input data input input text/plain ekitsch.in -infile=$value outfile Output output output text/plain ekitsch.out -outfile=$value besttree Search for best tree true -nobesttree power Power 3.0 -power=$value negbranch Negative branch lengths allowed false -negbranch random Randomize input order of species false -random randseed Random number seed (must be odd) -randseed=$value randtimes Number of times to jumble -randtimes=$value lt Lower-triangular data matrix false -lt ut Upper-triangular data matrix false -ut replicates Subreplicates false -replicates multsets Analyze multiple data sets false -multsets datasets How many data sets -datasets=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress drawtree Draw tree true -nodrawtree treefile Output output output text/plain ekitsch.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}ekitsch -auto $infile $outfile $besttree $power $negbranch $random $randseed $randtimes $lt $ut $replicates $multsets $datasets $printdata $progress $drawtree $treefile embossdata Utilities/Miscellaneous Utilities/embossdata TITLE embossdata (EMBOSS) INFO About Finds or fetches the data files read in by the EMBOSS programs (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/embossdata.html outf Output output output text/plain embossdata.out -outf=$value showall Show all potential EMBOSS data files -showall fetch Fetch a data file -fetch filename File to fetch or search for -filename=$value 0 Note This specifies the name of the file that should be fetched into the current directory or searched for in all of the directories that EMBOSS programs search when looking for a data file. The name of the file is not altered when it is fetched. reject Select directories -- Directories to ignore [select 1-4 values] 2||3||4 -reject=$value 1 Note This specifies the names of the sub-directories of the EMBOSS data directory that should be ignored when displaying data directories. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}embossdata -auto $outf $showall $fetch $filename $reject embossversion Utilities/Miscellaneous Utilities/embossversion TITLE embossversion (EMBOSS) INFO About Writes the current EMBOSS version number (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/embossversion.html outfile Output output output text/plain embossversion.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}embossversion -auto $outfile emix phylip/emix TITLE emix (EMBOSS) INFO About Mixed parsimony algorithm (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/emix.html infile Input data input input text/plain emix.in -infile=$value outfile Output output output text/plain emix.out -outfile=$value besttree Search for best tree true -nobesttree STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}emix -auto $infile $outfile $besttree emma Alignment/Multiple/emma TITLE emma (EMBOSS) INFO About Multiple alignment program - interface to ClustalW program (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/emma.html inseqs Input sequences input input biosequence/genbank emma.in.gb -inseqs=$value -sformat=genbank seqtype Sequence type gapany outseq Output sequence output output biosequence/genbank emma.out.gb -outseq=$value dendoutfile Output output output text/plain emma.out -dendoutfile=$value onlydend Do you want to produce only the dendrogram file? false -onlydend dend Do you want to use an old dendogram file? false -dend dendfile What is the name of the old dendrogram file NULL -dendfile=$value insist Insist that the sequence type is changed to protein false -insist prot Do not change this value -prot slowfast Please select one -- Do you want to carry out slow or fast pairwise alignment s -slowfast=$value 0 Note A distance is calculated between every pair of sequences and these are used to construct the dendrogram which guides the final multiple alignment. The scores are calculated from separate pairwise alignments. These can be calculated using 2 methods: dynamic programming (slow but accurate) or by the method of Wilbur and Lipman (extremely fast but approximate). The slow-accurate method is fine for short sequences but will be VERY SLOW for many (e.g. >100) long (e.g. >1000 residue) sequences. pwgapc Input value for gap open penalty 10.0 -pwgapc=$value 1 Note The penalty for opening a gap in the pairwise alignments. pwgapv Input value for gap extension penalty 0.1 -pwgapv=$value 2 Note The penalty for extending a gap by 1 residue in the pairwise alignments. pwmatrix Select matrix -- Protein pairwise alignment matrix options b -pwmatrix=$value 3 Note The scoring table which describes the similarity of each amino acid to each other. There are three 'in-built' series of weight matrices offered. Each consists of several matrices which work differently at different evolutionary distances. To see the exact details, read the documentation. Crudely, we store several matrices in memory, spanning the full range of amino acid distance (from almost identical sequences to highly divergent ones). For very similar sequences, it is best to use a strict weight matrix which only gives a high score to identities and the most favoured conservative substitutions. For more divergent sequences, it is appropriate to use 'softer' matrices which give a high score to many other frequent substitutions. 1) BLOSUM (Henikoff). These matrices appear to be the best available for carrying out data base similarity (homology searches). The matrices used are: Blosum80, 62, 45 and 30. 2) PAM (Dayhoff). These have been extremely widely used since the late '70s. We use the PAM 120, 160, 250 and 350 matrices. 3) GONNET . These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set. They appear to be more sensitive than the Dayhoff series. We use the GONNET 40, 80, 120, 160, 250 and 350 matrices. We also supply an identity matrix which gives a score of 1.0 to two identical amino acids and a score of zero otherwise. This matrix is not very useful. pwdnamatrix Select matrix -- DNA pairwise alignment matrix options i -pwdnamatrix=$value 4 Note The scoring table which describes the scores assigned to matches and mismatches (including IUB ambiguity codes). pairwisedata Input the filename of your pairwise matrix NULL -pairwisedata=$value ktup Fast pairwise alignment: similarity scores: K-Tuple size -ktup=$value 5 Note This is the size of exactly matching fragment that is used. INCREASE for speed (max= 2 for proteins; 4 for DNA), DECREASE for sensitivity. For longer sequences (e.g. >1000 residues) you may need to increase the default. Allowed values: integer from 0 to 4 gapw Fast pairwise alignment: similarity scores: gap penalty -gapw=$value 6 Note This is a penalty for each gap in the fast alignments. It has little affect on the speed or sensitivity except for extreme values. Allowed values: Positive integer topdiags Fast pairwise alignment: similarity scores: number of diagonals to be considered -topdiags=$value 7 Note The number of k-tuple matches on each diagonal (in an imaginary dot-matrix plot) is calculated. Only the best ones (with most matches) are used in the alignment. This parameter specifies how many. Decrease for speed; increase for sensitivity. Allowed values: Positive integer window Fast pairwise alignment: similarity scores: diagonal window size -window=$value 8 Note This is the number of diagonals around each of the 'best' diagonals that will be used. Decrease for speed; increase for sensitivity. Allowed values: Positive integer nopercent Fast pairwise alignment: similarity scores: suppresses percentage score false -nopercent matrix Select matrix -- Protein multiple alignment matrix options b -matrix=$value 9 Note This gives a menu where you are offered a choice of weight matrices. The default for proteins is the PAM series derived by Gonnet and colleagues. Note, a series is used! The actual matrix that is used depends on how similar the sequences to be aligned at this alignment step are. Different matrices work differently at each evolutionary distance. There are three 'in-built' series of weight matrices offered. Each consists of several matrices which work differently at different evolutionary distances. To see the exact details, read the documentation. Crudely, we store several matrices in memory, spanning the full range of amino acid distance (from almost identical sequences to highly divergent ones). For very similar sequences, it is best to use a strict weight matrix which only gives a high score to identities and the most favoured conservative substitutions. For more divergent sequences, it is appropriate to use 'softer' matrices which give a high score to many other frequent substitutions. 1) BLOSUM (Henikoff). These matrices appear to be the best available for carrying out data base similarity (homology searches). The matrices used are: Blosum80, 62, 45 and 30. 2) PAM (Dayhoff). These have been extremely widely used since the late '70s. We use the PAM 120, 160, 250 and 350 matrices. 3) GONNET . These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set. They appear to be more sensitive than the Dayhoff series. We use the GONNET 40, 80, 120, 160, 250 and 350 matrices. We also supply an identity matrix which gives a score of 1.0 to two identical amino acids and a score of zero otherwise. This matrix is not very useful. Alternatively, you can read in your own (just one matrix, not a series). dnamatrix Select matrix -- Nucleotide multiple alignment matrix options i -dnamatrix=$value 10 Note This gives a menu where you are offered amenu where a single matrix (not a series) can be selected. mamatrix Input the filename of your alignment matrix NULL -mamatrix=$value gapc Enter gap penalty 10.0 -gapc=$value 11 Note The penalty for opening a gap in the alignment. Increasing the gap opening penalty will make gaps less frequent. Allowed values: Positive foating point number gapv Enter variable gap penalty 5.0 -gapv=$value 12 Note The penalty for extending a gap by 1 residue. Increasing the gap extension penalty will make gaps shorter. Terminal gaps are not penalised. Allowed values: Positive foating point number unweighted Transitions are unweighted false -unweighted 13 Note The 'Transition weight' gives transitions (A <--> G or C <--> T i.e. purine-purine or pyrimidine-pyrimidine substitutions) a weight between 0 and 1; a weight of zero means that the transitions are scored as mismatches, while a weight of 1 gives the transitions the match score. For distantly related DNA sequences, the weight should be near to zero; for closely related sequences it can be useful to assign a higher score. endgaps Use end gap separation penalty false -endgaps 14 Note End gap separation' treats end gaps just like internal gaps for the purposes of avoiding gaps that are too close (set by 'gap separation distance'). If you turn this off, end gaps will be ignored for this purpose. This is useful when you wish to align fragments where the end gaps are not biologically meaningful. gapdist Gap separation distance 8 -gapdist=$value 15 Note Gap separation distance' tries to decrease the chances of gaps being too close to each other. Gaps that are less than this distance apart are penalised more than other gaps. This does not prevent close gaps; it makes them less frequent, promoting a block-like appearance of the alignment. Allowed values: Positive integer norgap No residue specific gaps false -norgap 16 Note Residue specific penalties' are amino acid specific gap penalties that reduce or increase the gap opening penalties at each position in the alignment or sequence. As an example, positions that are rich in glycine are more likely to have an adjacent gap than positions that are rich in valine. hgapres List of hydrophilic residues GPSNDQEKR -hgapres=$value 17 Note This is a set of the residues 'considered' to be hydrophilic. It is used when introducing Hydrophilic gap penalties. nohgap No hydrophilic gaps false -nohgap 18 Note Hydrophilic gap penalties' are used to increase the chances of a gap within a run (5 or more residues) of hydrophilic amino acids; these are likely to be loop or random coil regions where gaps are more common. The residues that are 'considered' to be hydrophilic are set by '-hgapres'. maxdiv Cut-off to delay the alignment of the most divergent sequences 30 -maxdiv=$value 19 Note This switch, delays the alignment of the most distantly related sequences until after the most closely related sequences have been aligned. The setting shows the percent identity level required to delay the addition of a sequence; sequences that are less identical than this level to any other sequences will be aligned later. Allowed values: Integer from 0 to 100 STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}emma -auto $inseqs $outseq $dendoutfile $onlydend $dend $dendfile $insist $prot $slowfast $pwgapc $pwgapv $pwmatrix $pwdnamatrix $pairwisedata $ktup $gapw $topdiags $window $nopercent $matrix $dnamatrix $mamatrix $gapc $gapv $unweighted $endgaps $gapdist $norgap $hgapres $nohgap $maxdiv emowse Protein/Composition/emowse TITLE emowse (EMBOSS) INFO About Protein identification by mass spectrometry (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/emowse.html sequences Input sequences input input biosequence/genbank emowse.in.gb -sequences=$value -sformat=genbank seqtype Sequence type protein infile Input data input input text/plain emowse.in -infile=$value enzyme Enzyme or reagent -- Enzymes and reagents 1 -enzyme=$value aadata Amino acid data file Eamino.dat -aadata=$value 0 Note Molecular weight data for amino acids weight Whole sequence molwt 0 -weight=$value pcrange Allowed whole sequence weight variability 25 -pcrange=$value frequencies Frequencies file Efreqs.dat -frequencies=$value tolerance tolerance -- enter a number 0.1 -tolerance=$value partials Partials factor 0.4 -partials=$value outfile Output output output text/plain emowse.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}emowse -auto $sequences $infile $enzyme $aadata $weight $pcrange $frequencies $tolerance $partials $outfile eneighbor phylip/eneighbor TITLE eneighbor (EMBOSS) INFO About Phylogenies from distance matrix by N-J or UPGMA method (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/eneighbor.html infile Input data input input text/plain eneighbor.in -infile=$value outfile Output output output text/plain eneighbor.out -outfile=$value trout Create a tree file true -notrout drawtree Draw tree true -nodrawtree treefile Output output output text/plain eneighbor.out -treefile=$value nj Neighbor-joining true -nonj og Outgroup root false -og outgnum number of the outgroup -outgnum=$value lt Lower-triangular data matrix false -lt ut Upper-triangular data matrix false -ut sr Subreplicates true -nosr random Randomize input order of species false -random randseed Random number seed (must be odd) -randseed=$value multsets Analyze multiple data sets false -multsets datasets How many data sets -datasets=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}eneighbor -auto $infile $outfile $trout $drawtree $treefile $nj $og $outgnum $lt $ut $sr $random $randseed $multsets $datasets $printdata $progress entrails Utilities/Miscellaneous Utilities/entrails TITLE entrails (EMBOSS) INFO About Reports the internal data from the EMBOSS code (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/entrails.html outfile Output output output text/plain entrails.out -outfile=$value fullreport Full report false -fullreport 0 Note By default, only the essential details are reported STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}entrails -auto $outfile $fullreport entret Sequence Edit/entret TITLE entret (EMBOSS) INFO About Reads and writes (returns) flatfile entries (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/entret.html sequence Input sequences input input biosequence/genbank entret.in.gb -sequence=$value -sformat=genbank outfile Output output output text/plain entret.out -outfile=$value firstonly Read one sequence and stop -firstonly STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}entret -auto $sequence $outfile $firstonly epenny phylip/epenny TITLE epenny (EMBOSS) INFO About Penny algorithm, branch-and-bound to find all most parsimonious trees (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/epenny.html infile Input data input input text/plain epenny.in -infile=$value outfile Output output output text/plain epenny.out -outfile=$value method Choose the method to use -- Method Wag -method=$value numgroups How many groups of 100 trees 1000 -numgroups=$value howoften How often to report, in trees 100 -howoften=$value simple Branch and bound is simple -simple og Outgroup root false -og outgnum number of the outgroup 1 -outgnum=$value thresh Use Threshold parsimony false -thresh valthresh threshold value 1.0 -valthresh=$value multsets Analyze multiple data sets false -multsets datasets How many data sets -datasets=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress steps Print out steps in each site false -steps seqatnodes Print sequences at all nodes of tree false -seqatnodes drawtree Draw tree true -nodrawtree trout Create a tree file true -notrout treefile Output output output text/plain epenny.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}epenny -auto $infile $outfile $method $numgroups $howoften $simple $og $outgnum $thresh $valthresh $multsets $datasets $printdata $progress $steps $seqatnodes $drawtree $trout $treefile eprotdist phylip/eprotdist TITLE eprotdist (EMBOSS) INFO About Protein distance algorithm (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/eprotdist.html msf Input sequences input input biosequence/genbank eprotdist.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany outfile Output output output text/plain eprotdist.out -outfile=$value method Choose the method to use -- Method Pam -method=$value categ Choose the categorie to use -- categorization of amino acids n all have groups: (Glu Gln Asp Asn), (Lys Arg His), (Phe Tyr Trp) plus:- G -categ=$value gencode Which genetic code -- Which genetic code U -gencode=$value prob Prob change category (1.0=easy) 0.457 -prob=$value tranrate Transition/transversion ratio 2.0 -tranrate=$value basefrequency Use empirical base frequencies true -nobasefrequency freqa Frequency for A 0.25 -freqa=$value freqc Frequency for C 0.25 -freqc=$value freqg Frequency for G 0.25 -freqg=$value freqt Frequency for T/U 0.25 -freqt=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}eprotdist -auto $msf $outfile $method $categ $gencode $prob $tranrate $basefrequency $freqa $freqc $freqg $freqt $printdata $progress eprotpars phylip/eprotpars TITLE eprotpars (EMBOSS) INFO About Protein parsimony algorithm (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/eprotpars.html msf Input sequences input input biosequence/genbank eprotpars.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany outfile Output output output text/plain eprotpars.out -outfile=$value besttree Search for best tree true -nobesttree random Randomize input order of species false -random randseed Random number seed (must be odd) 3 -randseed=$value randtimes How many times to randomise 3 -randtimes=$value og Outgroup root false -og outgnum number of the outgroup 1 -outgnum=$value thresh Use Threshold parsimony false -thresh valthresh threshold value 1.0 -valthresh=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress steps Print out steps in each site false -steps seqatnodes Print sequences at all nodes of tree false -seqatnodes drawtree Draw tree true -nodrawtree trout Create a tree file true -notrout treefile Output output output text/plain eprotpars.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}eprotpars -auto $msf $outfile $besttree $random $randseed $randtimes $og $outgnum $thresh $valthresh $printdata $progress $steps $seqatnodes $drawtree $trout $treefile equicktandem Nucleic/Repeats/equicktandem TITLE equicktandem (EMBOSS) INFO About Finds tandem repeats (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/equicktandem.html sequence Input sequences input input biosequence/genbank equicktandem.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna outfile Output output output text/plain equicktandem.out -outfile=$value maxrepeat Maximum repeat size 600 -maxrepeat=$value threshold Threshold score 20 -threshold=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}equicktandem -auto $sequence $outfile $maxrepeat $threshold erestml phylip/erestml TITLE erestml (EMBOSS) INFO About Restriction site Maximum Likelihood method (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/erestml.html datafile Input data input input text/plain erestml.in -datafile=$value outfile Output output output text/plain erestml.out -outfile=$value besttree Search for best tree true -nobesttree allsites Are all sites detected true -noallsites lengths Use lengths from user trees false -lengths sitelen Site length 6 -sitelen=$value extrap Extrapolation factor 100.0 -extrap=$value global Global rearrangements false -global random Randomize input order of species false -random randseed Random number seed (must be odd) 3 -randseed=$value randtimes How many times to randomise 3 -randtimes=$value og Outgroup root false -og outgnum number of the outgroup 1 -outgnum=$value multsets Analyze multiple data sets false -multsets datasets number of sets 2 -datasets=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress drawtree Draw tree true -nodrawtree trout Create a tree file true -notrout treefile Output output output text/plain erestml.out -treefile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}erestml -auto $datafile $outfile $besttree $allsites $lengths $sitelen $extrap $global $random $randseed $randtimes $og $outgnum $multsets $datasets $printdata $progress $drawtree $trout $treefile eseqboot phylip/eseqboot TITLE eseqboot (EMBOSS) INFO About Bootstrapped sequences algorithm (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/eseqboot.html datafile Input data input input text/plain eseqboot.in -datafile=$value outfile Output output output text/plain eseqboot.out -outfile=$value inter Interleaved input false -inter randseed Random number seed (must be odd) 3 -randseed=$value method Choose the method -- Method Seq -method=$value enzymes Present in input file false -enzymes all All alleles present at each locus false -all test Choose test -- test Boot -test=$value reps How many replicates 100 -reps=$value printdata Print out the data at start of run false -printdata progress Print indications of progress of run false -progress STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}eseqboot -auto $datafile $outfile $inter $randseed $method $enzymes $all $test $reps $printdata $progress est2genome Alignment/Global/est2genome TITLE est2genome (EMBOSS) INFO About Align EST and genomic DNA sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/est2genome.html est Input sequences input input biosequence/genbank est2genome.in.gb -est=$value -sformat=genbank seqtype Sequence type dna genome Input sequences input input biosequence/genbank est2genome.in.gb -genome=$value -sformat=genbank seqtype Sequence type dna match Score for matching two bases 1 -match=$value mismatch Cost for mismatching two bases 1 -mismatch=$value gappenalty Gap penalty 2 -gappenalty=$value 0 Note Cost for deleting a single base in either sequence, excluding introns intronpenalty Intron penalty 40 -intronpenalty=$value 1 Note Cost for an intron, independent of length. splicepenalty Splice site penalty 20 -splicepenalty=$value 2 Note Cost for an intron, independent of length and starting/ending on donor-acceptor sites minscore Minimum accepted score 30 -minscore=$value 3 Note You can exclude alignments with scores below a threshold by setting this to be false. reverse Reverse orientation -reverse 4 Note Reverse the orientation of the EST sequence splice Use donor and acceptor splice sites true -nosplice 5 Note Use donor and acceptor splice sites. If you want to ignore donor-acceptor sites then set this to be false. align Show the alignment -align 6 Note Show the alignment. The alignment includes the first and last 5 bases of each intron, together with the intron width. The direction of splicing is indicated by angle brackets (forward or reverse) or ???? (unknown). width Alignment width 50 -width=$value mode Comparison mode both -mode=$value 7 Note This determines the comparion mode. The default value is 'both', in which case both strands of the est are compared assuming a forward gene direction (ie GT/AG splice sites), and the best comparsion redone assuming a reversed (CT/AC) gene splicing direction. The other allowed modes are 'forward', when just the forward strand is searched, and 'reverse', ditto for the reverse strand. best Print out only best alignment true -nobest 8 Note You can print out all comparisons instead of just the best one by setting this to be false. space Space threshold (in megabytes) 10.0 -space=$value 9 Note for linear-space recursion. If product of sequence lengths divided by 4 exceeds this then a divide-and-conquer strategy is used to control the memory requirements. In this way very long sequences can be aligned. If you have a machine with plenty of memory you can raise this parameter (but do not exceed the machine's physical RAM) shuffle Shuffle -shuffle=$value seed Random number seed 20825 -seed=$value outfile Output output output text/plain est2genome.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}est2genome -auto $est $genome $match $mismatch $gappenalty $intronpenalty $splicepenalty $minscore $reverse $splice $align $width $mode $best $space $shuffle $seed $outfile etandem Nucleic/Repeats/etandem TITLE etandem (EMBOSS) INFO About Looks for tandem repeats in a nucleotide sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/etandem.html sequence Input sequences input input biosequence/genbank etandem.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna outfile Output output output text/plain etandem.out -outfile=$value minrepeat Minimum repeat size 10 -minrepeat=$value 0 Note Allowed values: Integer, 2 or higher maxrepeat Maximum repeat size -maxrepeat=$value 1 Note Allowed values: Integer, same as -minrepeat or higher threshold Threshold score 20 -threshold=$value mismatch Allow N as a mismatch -mismatch uniform Allow uniform consensus -uniform STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}etandem -auto $sequence $outfile $minrepeat $maxrepeat $threshold $mismatch $uniform extractfeat Sequence Edit/extractfeat Feature tables/extractfeat TITLE extractfeat (EMBOSS) INFO About Extract features from a sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/extractfeat.html sequence Input sequences input input biosequence/genbank extractfeat.in.gb -sequence=$value -sformat=genbank seqtype Sequence type any outseq Output sequence output output biosequence/genbank extractfeat.out.gb -outseq=$value before Amount of sequence before feature to extract 0 -before=$value 0 Note If this value is greater than 0 then that number of bases or residues before the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the start of the extracted sequence will be this number of bases/residues before the end of the feature. So a value of '10' will start the extraction 10 bases/residues before the start of the sequence, and a value of '-10' will start the extraction 10 bases/residues before the end of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence starts after the required start of the extraction. after Amount of sequence after feature to extract 0 -after=$value 1 Note If this value is greater than 0 then that number of bases or residues after the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the end of the extracted sequence will be this number of bases/residues after the start of the feature. So a value of '10' will end the extraction 10 bases/residues after the end of the sequence, and a value of '-10' will end the extraction 10 bases/residues after the start of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence ends before the required end of the extraction. source Source of feature to display * -source=$value 2 Note By default any feature source in the feature table is shown. You can se t this to match any feature source you wish to show. The source name is usuall y either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from. The source may be wildcarded by u sing '*'. If you wish to show more than one source, separate their names with the character '|', eg: gene* | embl type Type of feature to extract * -type=$value 3 Note By default every feature in the feature table is extracted. You can set this to be any feature type you wish to extract. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to extract more than one type, separate their names with the character '|', eg: *UTR | intron sense Sense of feature to extract 0 -sense=$value 4 Note By default any feature type in the feature table is extracted. You can set this to match any feature sense you wish. 0 - any sense, 1 - forward sense, -1 - reverse sense Default: 0 - any sense, 1 - forward sense, -1 - reverse sense minscore Minimum score of feature to extract 0.0 -minscore=$value 5 Note If this is greater than or equal to the maximum score, then any score is permitted maxscore Maximum score of feature to extract 0.0 -maxscore=$value 6 Note If this is less than or equal to the maximum score, then any score is permitted tag Tag of feature to extract * -tag=$value 7 Note Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default any feature tag in the feature table is extracted. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to extract more than one tag, separate their names with the character '|', eg: gene | label value Value of feature tags to extract * -value=$value 8 Note Tag values are the values associated with a feature tag. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Only some of these tags can have values, for example '/gene' can have the value of the gene name. By default any feature tag value in the feature table is shown. You can set this to match any feature tag valueyou wish to show. The tag value may be wildcarded by using '*'. If you wish to show more than one tag value, separate their names with the character '|', eg: pax* | 10 STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}extractfeat -auto $sequence $outseq $before $after $source $type $sense $minscore $maxscore $tag $value extractseq Sequence Edit/extractseq TITLE extractseq (EMBOSS) INFO About Extract regions from a sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/extractseq.html sequence Input sequences input input biosequence/genbank extractseq.in.gb -sequence=$value -sformat=genbank seqtype Sequence type any outseq Output sequence output output biosequence/genbank extractseq.out.gb -outseq=$value regions Regions to extract (eg: 4-57,78-94) -regions=$value 0 Note Regions to extract. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 separate Write regions to separate sequences false -separate 1 Note If this is set true then each specified region is written out as a separate sequence. The name of the sequence is created from the name of the original sequence with the start and end positions of the range appended with underscore characters between them, eg: XYZ region 2 to 34 is written as: XYZ_2_34 STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}extractseq -auto $sequence $outseq $regions $separate findkm Enzyme Kinetics/findkm TITLE findkm (EMBOSS) INFO About Find Km and Vmax for an enzyme reaction by a Hanes/Woolf plot (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/findkm.html infile Input data input input text/plain findkm.in -infile=$value outfile Output output output text/plain findkm.out -outfile=$value plot S/V vs S true -noplot graphlb graphlb png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graphlb=$value goutfile Output: graphlb output output image/pict findkm.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}findkm -auto $infile $outfile $plot $graphlb $goutfile freak Nucleic/Composition/freak TITLE freak (EMBOSS) INFO About Residue/base frequency table or plot (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/freak.html seqall Input sequences input input biosequence/genbank freak.in.gb -seqall=$value -sformat=genbank seqtype Sequence type any plot Produce graphic false -plot letters Residue letters gc -letters=$value step Stepping value 1 -step=$value window Averaging window 30 -window=$value graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value outfile Output output output text/plain freak.out -outfile=$value goutfile Output: graph output output image/pict freak.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}freak -auto $seqall $plot $letters $step $window $graph $outfile $goutfile fuzznuc Nucleic/Motifs/fuzznuc TITLE fuzznuc (EMBOSS) INFO About Nucleic acid pattern search (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/fuzznuc.html sequence Input sequences input input biosequence/genbank fuzznuc.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna pattern Search pattern -pattern=$value mismatch Number of mismatches 0 -mismatch=$value mmshow Show mismatches false -mmshow accshow Show accession numbers false -accshow descshow Show descriptions false -descshow usashow Show USA false -usashow 0 Note Showing the USA (Uniform Sequence Address) of the matching sequences will turn your output file into a 'list' file that can then be read in by many other EMBOSS programs by specifying it with a '@' in front of the filename. complement Search complementary strand false -complement outf Output output output text/plain fuzznuc.out -outf=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}fuzznuc -auto $sequence $pattern $mismatch $mmshow $accshow $descshow $usashow $complement $outf fuzzpro Protein/Motifs/fuzzpro TITLE fuzzpro (EMBOSS) INFO About Protein pattern search (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/fuzzpro.html sequence Input sequences input input biosequence/genbank fuzzpro.in.gb -sequence=$value -sformat=genbank seqtype Sequence type protein pattern Search pattern -pattern=$value mismatch Number of mismatches 0 -mismatch=$value mmshow Show mismatches false -mmshow accshow Show accession numbers false -accshow usashow Show USA false -usashow 0 Note Showing the USA (Uniform Sequence Address) of the matching sequences will turn your output file into a 'list' file that can then be read in by many other EMBOSS programs by specifying it with a '@' in front of the filename. descshow Show descriptions false -descshow outf Output output output text/plain fuzzpro.out -outf=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}fuzzpro -auto $sequence $pattern $mismatch $mmshow $accshow $usashow $descshow $outf fuzztran Nucleic/Motifs/fuzztran Protein/Motifs/fuzztran TITLE fuzztran (EMBOSS) INFO About Protein pattern search after translation (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/fuzztran.html sequence Input sequences input input biosequence/genbank fuzztran.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna frame Frame(s) to translate -- Translation frames 1 -frame=$value table Code to use -- Genetic codes 0 -table=$value pattern Search pattern -pattern=$value mismatch Number of mismatches 0 -mismatch=$value mmshow Show mismatches false -mmshow accshow Show accession numbers false -accshow usashow Show USA false -usashow 0 Note Showing the USA (Uniform Sequence Address) of the matching sequences will turn your output file into a 'list' file that can then be read in by many other EMBOSS programs by specifying it with a '@' in front of the filename. descshow Show descriptions false -descshow outf Output output output text/plain fuzztran.out -outf=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}fuzztran -auto $sequence $frame $table $pattern $mismatch $mmshow $accshow $usashow $descshow $outf garnier Protein/2D Structure/garnier TITLE garnier (EMBOSS) INFO About Predicts protein secondary structure (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/garnier.html sequencea Input sequences input input biosequence/genbank garnier.in.gb -sequencea=$value -sformat=genbank seqtype Sequence type PureProtein STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}garnier -auto $sequencea geecee Nucleic/CpG Islands/geecee TITLE geecee (EMBOSS) INFO About Calculates the fractional GC content of nucleic acid sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/geecee.html sequence Input sequences input input biosequence/genbank geecee.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna outfile Output output output text/plain geecee.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}geecee -auto $sequence $outfile getorf Nucleic/Gene finding/getorf TITLE getorf (EMBOSS) INFO About Finds and extracts open reading frames (ORFs) (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/getorf.html sequence Input sequences input input biosequence/genbank getorf.in.gb -sequence=$value -sformat=genbank seqtype Sequence type DNA outseq Output sequence output output biosequence/genbank getorf.out.gb -outseq=$value table Code to use -- Genetic codes 0 -table=$value minsize Minimum nucleotide size of ORF to report 30 -minsize=$value find Type of output -- Type of sequence to output 0 -find=$value 0 Note This is a small menu of possible output options. The first four options are to select either the protein translation or the original nucleic acid sequence of the open reading frame. There are two possible definitions of an open reading frame: it can either be a region that is free of STOP codons or a region that begins with a START codon and ends with a STOP codon. The last three options are probably only of interest to people who wish to investigate the statistical properties of the regions around potential START or STOP codons. The last option assumes that ORF lengths are calculated between two STOP codons. methionine Change initial START codons to Methionine true -nomethionine 1 Note START codons at the beginning of protein products will usually code for Methionine, despite what the codon will code for when it is internal to a protein. This qualifier sets all such START codons to code for Methionine by default. circular Is the sequence circular false -circular reverse Find ORFs in the reverse sequence true -noreverse 2 Note Set this to be false if you do not wish to find ORFs in the reverse complement of the sequence. flanking Number of flanking nucleotides to report 100 -flanking=$value 3 Note If you have chosen one of the options of the type of sequence to find that gives the flanking sequence around a STOP or START codon, this allows you to set the number of nucleotides either side of that codon to output. If the region of flanking nucleotides crosses the start or end of the sequence, no output is given for this codon. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}getorf -auto $sequence $outseq $table $minsize $find $methionine $circular $reverse $flanking helixturnhelix Protein/2D Structure/helixturnhelix Protein/Motifs/helixturnhelix TITLE helixturnhelix (EMBOSS) INFO About Report nucleic acid binding motifs (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/helixturnhelix.html sequence Input sequences input input biosequence/genbank helixturnhelix.in.gb -sequence=$value -sformat=genbank seqtype Sequence type PureProtein mean Mean value 238.71 -mean=$value sd Standard Deviation value 293.61 -sd=$value minsd Minimum SD 2.5 -minsd=$value eightyseven Use the old (1987) weight data -eightyseven STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}helixturnhelix -auto $sequence $mean $sd $minsd $eightyseven histogramtest Test/histogramtest TITLE histogramtest (EMBOSS) INFO About test of graphics (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/histogramtest.html sets Number of sets of data 1 -sets=$value points Number of data points per set 10 -points=$value bins Number of bars -bins=$value sidebyside Display sets next to each other 1 -sidebyside=$value xstart start value for x axis 0 -xstart=$value xend end value for x axis -xend=$value graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value goutfile Output: graph output output image/pict histogramtest.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}histogramtest -auto $sets $points $bins $sidebyside $xstart $xend $graph $goutfile hmoment Protein/2D Structure/hmoment TITLE hmoment (EMBOSS) INFO About Hydrophobic moment calculation (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/hmoment.html seqall Input sequences input input biosequence/genbank hmoment.in.gb -seqall=$value -sformat=genbank seqtype Sequence type pureprotein plot Produce graphic false -plot window Window 10 -window=$value aangle Alpha helix angle (degrees) 100 -aangle=$value bangle Beta sheet angle (degrees) 160 -bangle=$value baseline Graph marker line 0.35 -baseline=$value double Plot two graphs false -double graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value outfile Output output output text/plain hmoment.out -outfile=$value goutfile Output: graph output output image/pict hmoment.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}hmoment -auto $seqall $plot $window $aangle $bangle $baseline $double $graph $outfile $goutfile iep Protein/Composition/iep TITLE iep (EMBOSS) INFO About Calculates the isoelectric point of a protein (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/iep.html sequencea Input sequences input input biosequence/genbank iep.in.gb -sequencea=$value -sformat=genbank seqtype Sequence type pureprotein plot Plot charge vs pH false -plot report Write results to a file true -noreport step pH step value .5 -step=$value amino Number of N-termini 1 -amino=$value termini Include charge at N and C terminus true -notermini graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value outfile Output output output text/plain iep.out -outfile=$value goutfile Output: graph output output image/pict iep.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}iep -auto $sequencea $plot $report $step $amino $termini $graph $outfile $goutfile infoalign Alignment/Multiple/infoalign Information/infoalign TITLE infoalign (EMBOSS) INFO About Information on a multiple sequence alignment (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/infoalign.html sequence Input sequences input input biosequence/genbank infoalign.in.gb -sequence=$value -sformat=genbank seqtype Sequence type gapany outfile Output output output text/plain infoalign.out -outfile=$value refseq The number or the name of the reference sequence 0 -refseq=$value 0 Note If you give the number in the alignment or the name of a sequence, it will be taken to be the reference sequence. The reference sequence is the one against which all the other sequences are compared. If this is set to 0 then the consensus sequence will be used as the reference sequence. By default the consensus sequence is used as the reference sequence. matrix Similarity scoring Matrix file EDNAMAT -matrix=$value plurality Plurality check % for consensus 50.0 -plurality=$value 1 Note Set a cut-off for the % of positive scoring matches below which there is no consensus. The default plurality is taken as 50% of the total weight of all the sequences in the alignment. identity Required % of identities at a position fro consensus 0.0 -identity=$value 2 Note Provides the facility of setting the required number of identities at a position for it to give a consensus. Therefore, if this is set to 100% only columns of identities contribute to the consensus. html Format output as an HTML table false -html only Display the specified columns false -only 3 Note This is a way of shortening the command line if you only want a few things to be displayed. Instead of specifying: '-nohead -nousa -noname -noalign -nogaps -nogapcount -nosimcount -noidcount -nodiffcount' to get only the sequence length output, you can specify '-only -seqlength heading Display column headings -heading usa Display the USA of the sequence -usa name Display 'name' column -name seqlength Display 'seqlength' column -seqlength alignlength Display 'alignlength' column -alignlength gaps Display number of gaps -gaps gapcount Display number of gap positions -gapcount idcount Display number of identical positions -idcount simcount Display number of similar positions -simcount diffcount Display number of different positions -diffcount change Display % number of changed positions -change description Display 'description' column -description STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}infoalign -auto $sequence $outfile $refseq $matrix $plurality $identity $html $only $heading $usa $name $seqlength $alignlength $gaps $gapcount $idcount $simcount $diffcount $change $description infoseq Information/infoseq TITLE infoseq (EMBOSS) INFO About Displays some simple information about sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/infoseq.html sequence Input sequences input input biosequence/genbank infoseq.in.gb -sequence=$value -sformat=genbank outfile Output output output text/plain infoseq.out -outfile=$value html Format output as an HTML table false -html only Display the specified columns false -only 0 Note This is a way of shortening the command line if you only want a few things to be displayed. Instead of specifying: '-nohead -noname -noacc -notype -nopgc -nodesc' to get only the length output, you can specify '-only -length heading Display column headings -heading usa Display the USA of the sequence -usa name Display 'name' column -name accession Display 'accession' column -accession type Display 'type' column -type length Display 'length' column -length pgc Display 'percent GC content' column -pgc description Display 'description' column -description STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}infoseq -auto $sequence $outfile $html $only $heading $usa $name $accession $type $length $pgc $description isochore Nucleic/Composition/isochore TITLE isochore (EMBOSS) INFO About Plots isochores in large DNA sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/isochore.html sequence Input sequences input input biosequence/genbank isochore.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna out Output output output text/plain isochore.out -out=$value window Window size 1000 -window=$value shift Shift increment 100 -shift=$value graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value goutfile Output: graph output output image/pict isochore.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}isochore -auto $sequence $out $window $shift $graph $goutfile lindna Display/lindna TITLE lindna (EMBOSS) INFO About Draws linear maps of DNA constructs (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/lindna.html graphout graphout [device to be displayed on] png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graphout=$value inputfile Input data input input text/plain lindna.in -inputfile=$value intersymbol type of junctions between blocks (enter Straight, Up, Down, or No) Straight -intersymbol=$value intercolor color of junctions between blocks (enter a color number) 1 -intercolor=$value interticks do you want horizontal junctions between ticks (Y or N) N -interticks=$value gapsize interval between ticks in the ruler (enter an integer) 500 -gapsize=$value ticklines do you want vertical lines at the ruler's ticks (Y or N) N -ticklines=$value tickheight height of ticks (enter a number to multiply the default height) 1 -tickheight=$value blockheight height of blocks (enter a number to multiply the default height) 1 -blockheight=$value rangeheight height of range ends (enter a number to multiply the default height) 1 -rangeheight=$value gapgroup space between groups (enter a number to multiply the default space) 1 -gapgroup=$value postext space between text and ticks, blocks, and ranges (enter a number to multiply the default space) 1 -postext=$value goutfile Output: graphout output output image/pict lindna.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}lindna -auto $graphout $inputfile $intersymbol $intercolor $interticks $gapsize $ticklines $tickheight $blockheight $rangeheight $gapgroup $postext $goutfile listor Sequence Edit/listor TITLE listor (EMBOSS) INFO About Writes a list file of the logical OR of two sets of sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/listor.html firstset Input sequences input input biosequence/genbank listor.in.gb -firstset=$value -sformat=genbank secondset Input sequences input input biosequence/genbank listor.in.gb -secondset=$value -sformat=genbank outlist Output output output text/plain listor.out -outlist=$value operator Enter the logical operator to combine the sequences -- Logical operator to combine sequence lists OR -operator=$value 0 Note The following logical operators combine the sequences in the following ways: OR - gives all that occur in one set or the other AND - gives only those which occur in both sets XOR - gives those which only occur in one set or the other, but not in both NOT - gives those which occur in the first set except for those that also occur in the second STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}listor -auto $firstset $secondset $outlist $operator marscan Nucleic/Gene finding/marscan Nucleic/Motifs/marscan TITLE marscan (EMBOSS) INFO About Finds MAR/SAR sites in nucleic sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/marscan.html sequence Input sequences input input biosequence/genbank marscan.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna outf Output output output text/plain marscan.out -outf=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}marscan -auto $sequence $outf maskfeat Sequence Edit/maskfeat Feature tables/maskfeat TITLE maskfeat (EMBOSS) INFO About Mask off features of a sequence. (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/maskfeat.html sequence Input sequences input input biosequence/genbank maskfeat.in.gb -sequence=$value -sformat=genbank seqtype Sequence type any outseq Output sequence output output biosequence/genbank maskfeat.out.gb -outseq=$value type Type of feature to mask repeat* -type=$value 0 Note By default any feature in the feature table with a type starting 'repeat' is masked. You can set this to be any feature type you wish to mask. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to mask more than one type, separate their names with spaces or commas, eg: *UTR repeat* maskchar Character to mask with -maskchar=$value 1 Note Character to use when masking. Default is 'X' for protein sequences, 'N' for nucleic sequences. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}maskfeat -auto $sequence $outseq $type $maskchar maskseq Sequence Edit/maskseq TITLE maskseq (EMBOSS) INFO About Mask off regions of a sequence. (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/maskseq.html sequence Input sequences input input biosequence/genbank maskseq.in.gb -sequence=$value -sformat=genbank seqtype Sequence type any outseq Output sequence output output biosequence/genbank maskseq.out.gb -outseq=$value regions Regions to mask (eg: 4-57,78-94) -regions=$value 0 Note Regions to mask. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 maskchar Character to mask with -maskchar=$value 1 Note Character to use when masking. Default is 'X' for protein sequences, 'N' for nucleic sequences. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}maskseq -auto $sequence $outseq $regions $maskchar matcher Alignment/Local/matcher TITLE matcher (EMBOSS) INFO About Finds the best local alignments between two sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/matcher.html sequencea Input sequences input input biosequence/genbank matcher.in.gb -sequencea=$value -sformat=genbank seqtype Sequence type any sequenceb Input sequences input input biosequence/genbank matcher.in.gb -sequenceb=$value -sformat=genbank seqtype Sequence type @($(sequencea.protein) ? protein : nucleotide) STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}matcher -auto $sequencea $sequenceb megamerger Alignment/Consensus/megamerger TITLE megamerger (EMBOSS) INFO About Merge two large overlapping nucleic acid sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/megamerger.html seqa Input sequences input input biosequence/genbank megamerger.in.gb -seqa=$value -sformat=genbank seqtype Sequence type DNA seqb Input sequences input input biosequence/genbank megamerger.in.gb -seqb=$value -sformat=genbank seqtype Sequence type DNA outseq Output sequence output output biosequence/genbank megamerger.out.gb -outseq=$value report Output output output text/plain megamerger.out -report=$value wordsize Word size 20 -wordsize=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}megamerger -auto $seqa $seqb $outseq $report $wordsize merger Alignment/Consensus/merger TITLE merger (EMBOSS) INFO About Merge two overlapping nucleic acid sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/merger.html seqa Input sequences input input biosequence/genbank merger.in.gb -seqa=$value -sformat=genbank seqtype Sequence type DNA seqb Input sequences input input biosequence/genbank merger.in.gb -seqb=$value -sformat=genbank seqtype Sequence type DNA outseq Output sequence output output biosequence/genbank merger.out.gb -outseq=$value datafile Matrix file EDNAMAT -datafile=$value gapopen Gap opening penalty 50.0 -gapopen=$value gapextend Gap extension penalty 5 -gapextend=$value outfile Output alignment and explanation stdout -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}merger -auto $seqa $seqb $outseq $datafile $gapopen $gapextend $outfile msbar Nucleic/Mutation/msbar Protein/Mutation/msbar TITLE msbar (EMBOSS) INFO About Mutate sequence beyond all recognition (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/msbar.html sequence Input sequences input input biosequence/genbank msbar.in.gb -sequence=$value -sformat=genbank seqtype Sequence type any outseq Output sequence output output biosequence/genbank msbar.out.gb -outseq=$value count Number of times to perform the mutation operations 1 -count=$value inframe Do 'codon' and 'block' operations in frame false -inframe point Types of point mutations to perform -- Point mutation operations [select 1-4 values] 0 -point=$value codon Types of codon mutations to perform -- Codon mutation operations [select 1-4 values] 0 -codon=$value 0 Note Types of codon mutations to perform. These are only done if the sequence is nucleic. block Types of block mutations to perform -- Block mutation operations [select 1-4 values] 0 -block=$value minimum Minimum size for a block mutation 1 -minimum=$value maximum Maximum size for a block mutation 10 -maximum=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}msbar -auto $sequence $outseq $count $inframe $point $codon $block $minimum $maximum mwfilter Protein/Composition/mwfilter TITLE mwfilter (EMBOSS) INFO About Filter noisy molwts from mass spec output (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/mwfilter.html infile Input data input input text/plain mwfilter.in -infile=$value tolerance ppm tolerance 50.0 -tolerance=$value datafile Data file of noisy molecular weights Emwfilter.dat -datafile=$value outfile Output output output text/plain mwfilter.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}mwfilter -auto $infile $tolerance $datafile $outfile needle Alignment/Global/needle TITLE needle (EMBOSS) INFO About Needleman-Wunsch global alignment. (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/needle.html sequencea Input sequences input input biosequence/genbank needle.in.gb -sequencea=$value -sformat=genbank seqtype Sequence type any seqall Input sequences input input biosequence/genbank needle.in.gb -seqall=$value -sformat=genbank seqtype Sequence type @($(sequencea.protein) ? protein : nucleotide) datafile Matrix file EDNAMAT -datafile=$value gapopen Gap opening penalty -gapopen=$value 0 Note The gap open penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. Allowed values: Floating point number from 1.0 to 100.0 gapextend Gap extension penalty -gapextend=$value 1 Note The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. Allowed values: Floating point number from 0.0 to 10.0 similarity Display percent identity and similarity true -nosimilarity 2 Note Display percent identity and similarity fasta Output overlap as fasta sequences false -fasta 3 Note Output overlap as fasta sequences STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}needle -auto $sequencea $seqall $datafile $gapopen $gapextend $similarity $fasta newcpgreport Nucleic/CpG Islands/newcpgreport TITLE newcpgreport (EMBOSS) INFO About Report CpG rich areas (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/newcpgreport.html sequence Input sequences input input biosequence/genbank newcpgreport.in.gb -sequence=$value -sformat=genbank seqtype Sequence type DNA window Window size 100 -window=$value shift Shift increment 1 -shift=$value minlen Minimum Length 200 -minlen=$value minoe Minimum observed/expected 0.6 -minoe=$value minpc Minimum percentage 50. -minpc=$value outfile Output output output text/plain newcpgreport.out -outfile=$value obsexp Show observed/expected threshold line true -noobsexp cg Show CpG rich regions true -nocg pc Show percentage line true -nopc STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}newcpgreport -auto $sequence $window $shift $minlen $minoe $minpc $outfile $obsexp $cg $pc newcpgseek Nucleic/CpG Islands/newcpgseek TITLE newcpgseek (EMBOSS) INFO About Reports CpG rich regions (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/newcpgseek.html sequence Input sequences input input biosequence/genbank newcpgseek.in.gb -sequence=$value -sformat=genbank seqtype Sequence type DNA score CpG score 17 -score=$value outfile Output output output text/plain newcpgseek.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}newcpgseek -auto $sequence $score $outfile newseq Sequence Edit/newseq TITLE newseq (EMBOSS) INFO About Type in a short new sequence. (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/newseq.html outseq Output sequence output output biosequence/genbank newseq.out.gb -outseq=$value name Name of the sequence -name=$value 0 Note The name of of the sequence should be a single word that you will use to identify the sequence. It should have no (or few) punctuation characters in it. description Description of the sequence -description=$value 1 Note Enter any description of the sequence that you require. type Type of sequence -- Type of sequence N -type=$value sequence Enter the sequence -sequence=$value 2 Note The sequence itself. Because of the limitation of the operating system, you will only be able to type in a short sequence of (typically) 250 characters, or so. The keyboard will beep at you when you have reached this limit and you will not be able to press the RETURN/ENTER key until you have deleted a few characters. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}newseq -auto $outseq $name $description $type $sequence noreturn Sequence Edit/noreturn TITLE noreturn (EMBOSS) INFO About Removes carriage return from ASCII files (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/noreturn.html infile Input data input input text/plain noreturn.in -infile=$value outfile Output output output text/plain noreturn.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}noreturn -auto $infile $outfile notseq Sequence Edit/notseq TITLE notseq (EMBOSS) INFO About Excludes a set of sequences and writes out the remaining ones (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/notseq.html sequence Input sequences input input biosequence/genbank notseq.in.gb -sequence=$value -sformat=genbank outseq Output sequence output output biosequence/genbank notseq.out.gb -outseq=$value exclude Sequence names to exclude -exclude=$value 0 Note Enter a list of sequence names or accession numbers to exclude from the sequences read in. The excluded sequences will be written to the file specified in the 'junkout' parameter. The remainder will be written out to the file specified in the 'outseq' parameter. The list of sequence names can be separated by either spaces or commas. The sequence names can be wildcarded. The sequence names are case independent. An example of a list of sequences to be excluded is: myseq, hs*, one two three junkout Output sequence output output biosequence/genbank notseq.out.gb -junkout=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}notseq -auto $sequence $outseq $exclude $junkout nrscope Utilities/Database creation/nrscope TITLE nrscope (EMBOSS) INFO About Converts redundant EMBL-format SCOP file to non-redundant one (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/nrscope.html scopin Input data input input text/plain nrscope.in -scopin=$value scopout Output output output text/plain nrscope.out -scopout=$value dpdb Location of clean domain coordinate files for input (embl-like format) ./ -dpdb=$value extn File extension of clean domain coordinate files .pxyz -extn=$value thresh The % sequence identity redundancy threshold 95.0 -thresh=$value datafile Residue substitution matrix EDNAMAT -datafile=$value gapopen Gap insertion penalty 10 -gapopen=$value 0 Note The gap insertion penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. Allowed values: Floating point number from 1.0 to 100.0 gapextend Gap extension penalty 0.5 -gapextend=$value 1 Note The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. Allowed values: Floating point number from 0.0 to 10.0 errf Output output output text/plain nrscope.out -errf=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}nrscope -auto $scopin $scopout $dpdb $extn $thresh $datafile $gapopen $gapextend $errf nthseq Sequence Edit/nthseq TITLE nthseq (EMBOSS) INFO About Writes one sequence from a multiple set of sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/nthseq.html sequence Input sequences input input biosequence/genbank nthseq.in.gb -sequence=$value -sformat=genbank number The number of the sequence to output 1 -number=$value outseq Output sequence output output biosequence/genbank nthseq.out.gb -outseq=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}nthseq -auto $sequence $number $outseq octanol Protein/Composition/octanol TITLE octanol (EMBOSS) INFO About Displays protein hydropathy (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/octanol.html sequencea Input sequences input input biosequence/genbank octanol.in.gb -sequencea=$value -sformat=genbank seqtype Sequence type pureprotein graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value datafile Input data input input text/plain octanol.in -datafile=$value width window size 19 -width=$value octanolplot Display the octanol plot false -octanolplot interfaceplot Display the interface plot false -interfaceplot differenceplot Do not display the difference plot true -nodifferenceplot goutfile Output: graph output output image/pict octanol.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}octanol -auto $sequencea $graph $datafile $width $octanolplot $interfaceplot $differenceplot $goutfile oddcomp Protein/Motifs/oddcomp TITLE oddcomp (EMBOSS) INFO About Finds protein sequence regions with a biased composition (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/oddcomp.html sequence Input sequences input input biosequence/genbank oddcomp.in.gb -sequence=$value -sformat=genbank seqtype Sequence type Protein outfile Output output output text/plain oddcomp.out -outfile=$value compdata Input data input input text/plain oddcomp.in -compdata=$value window Window size to consider (e.g. 30 aa) 30 -window=$value 0 Note This is the size of window in which to count. Thus if you want to count frequencies in a 40 aa stretch you should enter 40 here. ignorebz Ignore the amino acids B and Z and just count them as 'Other true -noignorebz 1 Note The amino acid code B represents Asparagine or Aspartic acid and the code Z represents Glutamine or Glutamic acid. These are not commonly used codes and you may wish not to count words containing them, just noting them in the count of 'Other' words. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}oddcomp -auto $sequence $outfile $compdata $window $ignorebz palindrome Nucleic/Repeats/palindrome TITLE palindrome (EMBOSS) INFO About Looks for inverted repeats in a nucleotide sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/palindrome.html insequence Input sequences input input biosequence/genbank palindrome.in.gb -insequence=$value -sformat=genbank seqtype Sequence type nucleotide minpallen Enter minimum length of palindrome 10 -minpallen=$value maxpallen Enter maximum length of palindrome 100 -maxpallen=$value gaplimit Enter maximum gap between repeated regions 100 -gaplimit=$value nummismatches Number of mismatches allowed 0 -nummismatches=$value 0 Note Allowed values: Positive integer outfile Output output output text/plain palindrome.out -outfile=$value overlap Report overlapping matches true -nooverlap STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}palindrome -auto $insequence $minpallen $maxpallen $gaplimit $nummismatches $outfile $overlap pasteseq Sequence Edit/pasteseq TITLE pasteseq (EMBOSS) INFO About Insert one sequence into another (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/pasteseq.html sequence Input sequences input input biosequence/genbank pasteseq.in.gb -sequence=$value -sformat=genbank seqtype Sequence type any insseq Input sequences input input biosequence/genbank pasteseq.in.gb -insseq=$value -sformat=genbank seqtype Sequence type @($(sequence.protein) ? protein : nucleotide) outseq Output sequence output output biosequence/genbank pasteseq.out.gb -outseq=$value pos Position to insert after -pos=$value 0 Note The position in the main input sequence to insert after. To insert before the start use the position 0. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}pasteseq -auto $sequence $insseq $outseq $pos patmatdb Protein/Motifs/patmatdb TITLE patmatdb (EMBOSS) INFO About Search a protein sequence with a motif (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/patmatdb.html sequence Input sequences input input biosequence/genbank patmatdb.in.gb -sequence=$value -sformat=genbank seqtype Sequence type Protein motif Protein motif to search for -motif=$value 0 Note Patterns for patmatdb are based on the format of pattern used in the PROSITE database. For example: '[DE](2)HS{P}X(2)PX(2,4)C' means two Asps or Glus in any order followed by His, Ser, any residue other then Pro, then two of any residue followed by Pro followed by two to four of any residue followed by Cys. The search is case-independent, so 'AAA' matches 'aaa'. outfile Output output output text/plain patmatdb.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}patmatdb -auto $sequence $motif $outfile patmatmotifs Protein/Motifs/patmatmotifs TITLE patmatmotifs (EMBOSS) INFO About Search a PROSITE motif database with a protein sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/patmatmotifs.html sequence Input sequences input input biosequence/genbank patmatmotifs.in.gb -sequence=$value -sformat=genbank seqtype Sequence type Protein outfile Output output output text/plain patmatmotifs.out -outfile=$value full Provide full documentation for matching patterns false -full prune Ignore simple patterns true -noprune 0 Note Ignore simple patterns. If this is true then these simple post-translational modification sites are not reported: myristyl, asn_glycosylation, camp_phospho_site, pkc_phospho_site, ck2_phospho_site, and tyr_phospho_site. STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}patmatmotifs -auto $sequence $outfile $full $prune patmattest Test/patmattest TITLE patmattest (EMBOSS) INFO About test of pattern matching (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/patmattest.html sequence Input sequences input input biosequence/genbank patmattest.in.gb -sequence=$value -sformat=genbank seqtype Sequence type any expression Regular expression to search sequence for. -expression=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}patmattest -auto $sequence $expression pepcoil Protein/2D Structure/pepcoil Protein/Motifs/pepcoil TITLE pepcoil (EMBOSS) INFO About Predicts coiled coil regions (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/pepcoil.html sequence Input sequences input input biosequence/genbank pepcoil.in.gb -sequence=$value -sformat=genbank seqtype Sequence type PureProtein window Window size 28 -window=$value coil Report coiled coil regions true -nocoil frame Show coil frameshifts -frame other Report non coiled coil regions true -noother outfile Output output output text/plain pepcoil.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}pepcoil -auto $sequence $window $coil $frame $other $outfile pepinfo Protein/Composition/pepinfo TITLE pepinfo (EMBOSS) INFO About Plots simple amino acid properties in parallel (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/pepinfo.html inseq Input sequences input input biosequence/genbank pepinfo.in.gb -inseq=$value -sformat=genbank seqtype Sequence type protein graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value outfile Output output output text/plain pepinfo.out -outfile=$value generalplot plot histogram of general properties true -nogeneralplot hydropathyplot plot graphs of hydropathy true -nohydropathyplot hwindow Window size for hydropathy averaging 9 -hwindow=$value aaproperties Enter user defined file of amino acid properties or leave blank Eaa_properties.dat -aaproperties=$value aahydropathy Enter user defined file of hydropathy data or leave blank Eaa_hydropathy.dat -aahydropathy=$value goutfile Output: graph output output image/pict pepinfo.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}pepinfo -auto $inseq $graph $outfile $generalplot $hydropathyplot $hwindow $aaproperties $aahydropathy $goutfile pepnet Display/pepnet Protein/2D Structure/pepnet TITLE pepnet (EMBOSS) INFO About Displays proteins as a helical net (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/pepnet.html sequence Input sequences input input biosequence/genbank pepnet.in.gb -sequence=$value -sformat=genbank seqtype Sequence type Protein amphipathic Prompt for amphipathic residue marking -amphipathic 0 Note If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked. This overrides any other markup that you may have specified using the qualifiers '-squares', '-diamonds' and '-octags'. squares Mark as squares ILVM -squares=$value 1 Note By default the aliphatic residues ILVM are marked with squares. diamonds Mark as diamonds DENQST -diamonds=$value 2 Note By default the residues DENQST are marked with diamonds. octags Mark as octagons HKR -octags=$value 3 Note By default the positively charged residues HKR are marked with octagons. data Display as data false -data 4 Note Output the data to a file instead of plotting it graph graph [device to be displayed on] png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value goutfile Output: graph output output image/pict pepnet.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}pepnet -auto $sequence $amphipathic $squares $diamonds $octags $data $graph $goutfile pepstats Protein/Composition/pepstats TITLE pepstats (EMBOSS) INFO About Protein statistics (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/pepstats.html sequencea Input sequences input input biosequence/genbank pepstats.in.gb -sequencea=$value -sformat=genbank seqtype Sequence type PureProtein termini Include charge at N and C terminus true -notermini aadata Amino acid data file Eamino.dat -aadata=$value 0 Note Molecular weight data for amino acids outfile Output output output text/plain pepstats.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}pepstats -auto $sequencea $termini $aadata $outfile pepwheel Display/pepwheel Protein/2D Structure/pepwheel TITLE pepwheel (EMBOSS) INFO About Shows protein sequences as helices (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/pepwheel.html sequence Input sequences input input biosequence/genbank pepwheel.in.gb -sequence=$value -sformat=genbank seqtype Sequence type Protein amphipathic Prompt for amphipathic residue marking -amphipathic 0 Note If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked. This overrides any other markup that you may have specified using the qualifiers '-squares', '-diamonds' and '-octags'. wheel Plot the wheel true -nowheel steps Number of steps 18 -steps=$value 1 Note The number of residues plotted per turn is this value divided by the 'turns' value. turns Number of turns 5 -turns=$value 2 Note The number of residues plotted per turn is the 'steps' value divided by this value. squares Mark as squares ILVM -squares=$value 3 Note By default the aliphatic residues ILVM are marked with squares. diamonds Mark as diamonds DENQST -diamonds=$value 4 Note By default the residues DENQST are marked with diamonds. octags Mark as octagons HKR -octags=$value 5 Note By default the positively charged residues HKR are marked with octagons. data Display as data false -data 6 Note Output the match data to a file instead of plotting it graph graph [device to be displayed on] png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value outfile Output output output text/plain pepwheel.out -outfile=$value goutfile Output: graph output output image/pict pepwheel.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}pepwheel -auto $sequence $amphipathic $wheel $steps $turns $squares $diamonds $octags $data $graph $outfile $goutfile pepwindow Protein/Composition/pepwindow TITLE pepwindow (EMBOSS) INFO About Displays protein hydropathy (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/pepwindow.html sequencea Input sequences input input biosequence/genbank pepwindow.in.gb -sequencea=$value -sformat=genbank seqtype Sequence type pureprotein graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value datafile Input data input input text/plain pepwindow.in -datafile=$value length window size 7 -length=$value goutfile Output: graph output output image/pict pepwindow.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}pepwindow -auto $sequencea $graph $datafile $length $goutfile pepwindowall Protein/Composition/pepwindowall TITLE pepwindowall (EMBOSS) INFO About Displays protein hydropathy of a set of sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/pepwindowall.html msf Input sequences input input biosequence/genbank pepwindowall.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapprotein graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value datafile Input data input input text/plain pepwindowall.in -datafile=$value length window size 7 -length=$value goutfile Output: graph output output image/pict pepwindowall.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}pepwindowall -auto $msf $graph $datafile $length $goutfile plotcon Alignment/Multiple/plotcon TITLE plotcon (EMBOSS) INFO About Plots the quality of conservation of a sequence alignment (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/plotcon.html msf Input sequences input input biosequence/genbank plotcon.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany winsize Window size 4 -winsize=$value 0 Note Number of columns to average alignment quality over. The larger this value is, the smoother the plot will be. scorefile Comparison matrix file EDNAMAT -scorefile=$value data Display as data false -data 1 Note Output the match data to a file instead of plotting it graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value outfile Output output output text/plain plotcon.out -outfile=$value goutfile Output: graph output output image/pict plotcon.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}plotcon -auto $msf $winsize $scorefile $data $graph $outfile $goutfile plotorf Nucleic/Gene finding/plotorf Nucleic/Translation/plotorf TITLE plotorf (EMBOSS) INFO About Plot potential open reading frames (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/plotorf.html sequence Input sequences input input biosequence/genbank plotorf.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna graph graph png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value start Start codons ATG -start=$value stop Stop codons TAA,TAG,TGA -stop=$value goutfile Output: graph output output image/pict plotorf.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}plotorf -auto $sequence $graph $start $stop $goutfile polydot Alignment/Dot plots/polydot TITLE polydot (EMBOSS) INFO About Displays all-against-all dotplots of a set of sequences (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/polydot.html sequences Input sequences input input biosequence/genbank polydot.in.gb -sequences=$value -sformat=genbank seqtype Sequence type any wordsize Word size 6 -wordsize=$value data Display as data false -data 0 Note Output the match data to a file instead of plotting it graph graph [device to be displayed on] png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value gap Gap (in residues) between dotplots 10 -gap=$value 1 Note This specifies the size of the gap that is used to separate the individual dotplots in the display. The size is measured in residues, as displayed in the output. boxit Draw a box around each dotplot true -noboxit dumpfeat Dump all matches as feature files false -dumpfeat format format to Dump out as gff -format=$value ext Extension for feature file gff -ext=$value outfile Output output output text/plain polydot.out -outfile=$value goutfile Output: graph output output image/pict polydot.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}polydot -auto $sequences $wordsize $data $graph $gap $boxit $dumpfeat $format $ext $outfile $goutfile preg Protein/Motifs/preg TITLE preg (EMBOSS) INFO About Regular expression search of a protein sequence (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/preg.html sequence Input sequences input input biosequence/genbank preg.in.gb -sequence=$value -sformat=genbank seqtype Sequence type protein outfile Output output output text/plain preg.out -outfile=$value pattern Regular expression pattern -pattern=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}preg -auto $sequence $outfile $pattern prettyplot Alignment/Multiple/prettyplot Display/prettyplot TITLE prettyplot (EMBOSS) INFO About Displays aligned sequences, with colouring and boxing (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/prettyplot.html msf Input sequences input input biosequence/genbank prettyplot.in.gb -msf=$value -sformat=genbank seqtype Sequence type gapany residuesperline Number of residues to be displayed on each line 50 -residuesperline=$value 0 Note The number of residues to be displayed on each line resbreak Residues before a space -resbreak=$value ccolours Colour residues by their consensus value. true -noccolours cidentity Colour to display identical residues (RED) RED -cidentity=$value csimilarity Colour to display similar residues (GREEN) GREEN -csimilarity=$value cother Colour to display other residues (BLACK) BLACK -cother=$value docolour Colour residues by table oily, amide etc. false -docolour title Do not display the title true -notitle shade shading -shade=$value 1 Note Set to BPLW for normal shading so for pair = 1.5,1.0,0.5 and shade = BPLW Residues score Colour 1.5 or over....... BLACK (B) 1.0 to 1.5 ....... BROWN (P) 0.5 to 1.0 ....... WHEAT (L) under 0.5 ....... WHITE (W) The only four letters allowed are BPLW, in any order. pair Values to represent identical similar related 1.5,1.0,0.5 -pair=$value identity Only match those which are identical in all sequences. 0 -identity=$value box Display prettyboxes true -nobox boxcol Colour the background in the boxes false -boxcol boxcolval Colour to be used for background. (GREY) GREY -boxcolval=$value consensus Display the consensus false -consensus name Display the sequence names true -noname maxnamelen Margin size for the sequence name. 10 -maxnamelen=$value number Display the residue number true -nonumber listoptions Display the date and options used true -nolistoptions plurality Plurality check value (totweight/2) -plurality=$value collision Allow collisions in calculating consensus true -nocollision alternative Use alternative collisions routine 0 -alternative=$value 2 Note Use alternative collisions routine 0) Normal collision check. (default) 1) checks identical scores with the max score found. So if any other residue matches the identical score then a collision has occurred. 2) If another residue has a greater than or equal to matching score and these do not match then a collision has occurred. 3) Checks all those not in the current consensus.If any of these give a top score for matching or identical scores then a collision has occured. portrait Set page to Portrait false -portrait matrixfile Matrix file EDNAMAT -matrixfile=$value showscore Print residue scores -1 -showscore=$value data data false -data graph graph [device to be displayed on] png|postscript|mac|mac8|colourps|hpgl |meta|tektronics|x11|none|data -graph=$value goutfile Output: graph output output image/pict prettyplot.pict -goutfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}prettyplot -auto $msf $residuesperline $resbreak $ccolours $cidentity $csimilarity $cother $docolour $title $shade $pair $identity $box $boxcol $boxcolval $consensus $name $maxnamelen $number $listoptions $plurality $collision $alternative $portrait $matrixfile $showscore $data $graph $goutfile prettyseq Display/prettyseq Nucleic/Translation/prettyseq TITLE prettyseq (EMBOSS) INFO About Output sequence with translated ranges (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/prettyseq.html sequence Input sequences input input biosequence/genbank prettyseq.in.gb -sequence=$value -sformat=genbank seqtype Sequence type DNA cfile Codon usage file Eacc.cut|Eadenovirus5.cut|Eadenovirus7.cut|Eaidlav.cut|Eanasp.cut|Eani.cut |Eanidmit.cut|Easn.cut|Eath.cut|Eatu.cut|Eavi.cut|Ebja.cut |Ebly.cut|Ebme.cut|Ebmo.cut|Ebna.cut|Ebov.cut|Ebovsp.cut |Ebst.cut|Ebsu.cut|Ecac.cut|Ecal.cut|Eccr.cut|Ecel.cut |Echi.cut|Echicken.cut|Echisp.cut|Echk.cut|Echmp.cut|Echnt.cut |Echos.cut|Echzm.cut|Echzmrubp.cut|Ecpx.cut|Ecre.cut|Ecrisp.cut |Ectr.cut|Edayhoff.cut|Eddi.cut|Edog.cut|Edro.cut|Edrosophila.cut |Eeca.cut|Eeco.cut|Eecoli.cut|Ef1.cut|Efish.cut|Efmdvpolyp.cut |Eham.cut|Ehha.cut|Ehin.cut|Ehma.cut|Ehum.cut|Ehuman.cut |Ekla.cut|Ekpn.cut|Ella.cut|Emac.cut|Emaize.cut|Emixlg.cut |Emouse.cut|Emsa.cut|Emse.cut|Emta.cut|Emtu.cut|Emus.cut |Emussp.cut|Emva.cut|Emze.cut|Emzecp.cut|Encr.cut|Eneu.cut |Engo.cut|Eoncsp.cut|Epae.cut|Epea.cut|Epet.cut|Epfa.cut |Ephix174.cut|Ephv.cut|Ephy.cut|Epig.cut|Epolyomaa2.cut|Epombe.cut |Epombecai.cut|Epot.cut|Eppu.cut|Epse.cut|Epsy.cut|Epvu.cut |Erab.cut|Erabbit.cut|Erabsp.cut|Erat.cut|Eratsp.cut|Erca.cut |Erhm.cut|Eric.cut|Erle.cut|Erme.cut|Ersp.cut|Esalsp.cut |Esau.cut|Esco.cut|Esgi.cut|Eshp.cut|Eshpsp.cut|Esli.cut |Eslm.cut|Esma.cut|Esmi.cut|Esmu.cut|Esoy.cut|Espi.cut |Espn.cut|Espo.cut|Espu.cut|Esta.cut|Esty.cut|Esus.cut |Esv40.cut|Esyhsp.cut|Esynsp.cut|Etbr.cut|Etcr.cut|Eter.cut |Etetsp.cut|Etob.cut|Etobcp.cut|Etom.cut|Etrb.cut|Evco.cut |Ewht.cut|Exel.cut|Exenopus.cut|Eyeast.cut|Eyeastcai.cut|Eyen.cut |Eysc.cut|Eyscmt.cut|Eysp.cut|Ezebrafish.cut|Ezma.cut -cfile=$value range Range(s) to translate -range=$value width Width of screen 60 -width=$value ruler Add a ruler true -noruler plabel Number translations true -noplabel nlabel Number DNA sequence true -nonlabel outfile Output output output text/plain prettyseq.out -outfile=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}prettyseq -auto $sequence $cfile $range $width $ruler $plabel $nlabel $outfile prima Nucleic/Primers/prima TITLE prima (EMBOSS) INFO About Selects primers for PCR and DNA amplification. (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/prima.html sequence Input sequences input input biosequence/genbank prima.in.gb -sequence=$value -sformat=genbank targetrange Specify a Target Range? false -targetrange targetstart Target start position. -targetstart=$value targetend Target end position. -targetend=$value overlap Minimum overlap of sequences 50 -overlap=$value minprimerlen Minimum primer length 18 -minprimerlen=$value maxprimerlen Maximum primer length 22 -maxprimerlen=$value minpmgccont Minimum primer GC fraction .40 -minpmgccont=$value maxpmgccont Maximum primer GC fraction .55 -maxpmgccont=$value minprimertm Minimum Primer Tm (deg Celsius) 53 -minprimertm=$value maxprimertm Maximum Primer Tm (deg Celsius) 58 -maxprimertm=$value minprodlen Minimum product length 100 -minprodlen=$value maxprodlen Maximum product length 300 -maxprodlen=$value minprodgccont Minimum product GC fraction .40 -minprodgccont=$value maxprodgccont Maximum product GC fraction .55 -maxprodgccont=$value saltconc Salt concentration (mM) 50 -saltconc=$value dnaconc DNA concentration (mM) 50 -dnaconc=$value list Force list-style output false -list outf Output output output text/plain prima.out -outf=$value STDOUT Std. output output text/plain stdout $stdout STDERR Errors output text/plain stderr $stderr ${empath}prima -auto $sequence $targetrange $targetstart $targetend $overlap $minprimerlen $maxprimerlen $minpmgccont $maxpmgccont $minprimertm $maxprimertm $minprodlen $maxprodlen $minprodgccont $maxprodgccont $saltconc $dnaconc $list $outf primer3 Nucleic/Primers/primer3 TITLE primer3 (EMBOSS) INFO About Picks PCR primers and hybridization oligos (EMBOSS) HELP Help http://www.uk.embnet.org/Software/EMBOSS/Apps/primer3.html input Input options true sequence Input sequences input input biosequence/genbank primer3.in.gb -sequence=$value -sformat=genbank seqtype Sequence type dna advanced Advanced options true program Program Options true explainflag Explain flag false -explainflag 0 Note If this flag is non-0, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that Primer3 examined, and statistics on the number discarded for various reasons. fileflag Create results files for each sequence false -fileflag 1 Note If the associated value is non-0, then Primer3 creates two output files for each input SEQUENCE. File (sequence-id).for lists all acceptable forward primers for (sequence-id), and (sequence-id).rev lists all acceptable reverse primers for (sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, Primer3 produces a file (sequence-id).int, which lists all acceptable internal oligos. task Select task -- Task 0 -task=$value 2 Note Tell Primer3 what task to perform. Legal values are 0: 'Pick PCR primers', 1: 'Pick PCR primers and hybridization probe', 2: 'Pick forward primer only', 3: 'Pick reverse primer only', 4: 'Pick hybridization probe only'. The tasks should be self explanatory. Briefly, an 'internal oligo' is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification. numreturn Number of results to return 5 -numreturn=$value 3 Note The maximum number of primer pairs to return. Primer pairs returned are sorted by their 'quality', in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time. firstbaseindex First base index 1 -firstbaseindex=$value 4 Note This parameter is the index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) sequenceopt Sequence options true includedregion Included region(s) -includedregion=$value 5 Note A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form (start),(end) where (start) is the index of the first base to consider, and (end) is the last in the primer-picking region. target Target region(s) -target=$value 6 Note If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of (start),(end) pairs where (start) is the index of the first base of a Target, and (end) is the last E.g. 50,51 requires primers to surround the 2 bases at positions 50 and 51. excludedregion Excluded region(s) -excludedregion=$value 7 Note Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of (start),(end) pairs where (start) is the index of the first base of the excluded region, and and (end) is the last. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs. E.g. 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68. forwardinput Forward input primer sequence to check -forwardinput=$value 8 Note The sequence of a forward primer to check and around which to design reverse primers and optional internal oligos. Must be a substring of SEQUENCE. reverseinput Reverse input primer sequence to check -reverseinput=$value 9 Note The sequence of a reverse primer to check and around which to design forward primers and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE. primer Primer Details true pickanyway Pick anyway false -pickanyway 10 Note If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violates specific constraints. mispriminglibrary Input data input input text/plain primer3.in -mispriminglibrary=$value maxmispriming Primer maximum mispriming 12.00 -maxmispriming=$value 11 Note The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY. pairmaxmispriming Primer pair maximum mispriming 24.00 -pairmaxmispriming=$value 12 Note The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING-LIBRARY. gcclamp GC clamp 0 -gcclamp=$value 13 Note Require the specified number of consecutive Gs and Cs at the 3' end of both the forward and reverse primer. (This parameter has no effect on the internal oligo if one is requested.) osize Primer optimum size 20 -osize=$value 14 Note Optimum length (in bases) of a primer oligo. Primer3 will attempt to pick primers close to this length. minsize Primer minimum size 18 -minsize=$value 15 Note Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX-SIZE. maxsize Primer maximum size 27 -maxsize=$value 16 Note Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which Primer3's melting-temperature is valid. otm Primer optimum Tm 60.0 -otm=$value 17 Note Optimum melting temperature(Celsius) for a primer oligo. Primer3 will try to pick primers with melting temperatures are close to this temperature. The oligo melting temperature formula in Primer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion. mintm Primer minimum Tm 57.0 -mintm=$value 18 Note Minimum acceptable melting temperature(Celsius) for a primer oligo. maxtm Primer maximum Tm 63.0 -maxtm=$value 19 Note Maximum acceptable melting temperature(Celsius) for a primer oligo. maxdifftm Maximum difference in Tm of primers 100.0 -maxdifftm=$value 20 Note Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers. ogcpercent Primer optimum GC percent 50.0 -ogcpercent=$value 21 Note Primer optimum GC percent. mingc Primer minimum GC percent 20.0 -mingc=$value 22 Note Minimum allowable percentage of Gs and Cs in any primer. maxgc Primer maximum GC percent 80.0 -maxgc=$value 23 Note Maximum allowable percentage of Gs and Cs in any primer generated by Primer. saltconc Salt concentration (mM) 50.0 -saltconc=$value 24 Note The millimolar concentration of salt (usually KCl) in the PCR. Primer3 uses this argument to calculate oligo melting temperatures. dnaconc DNA concentration (nM) 50.0 -dnaconc=$value 25 Note The nanomolar concentration of annealing oligos in the PCR. Primer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 12) where a suitable value (for a lower initial concentration of template) is 'empirically determined'. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures. See ADVICE FOR PICKING PRIMERS. numnsaccepted Maximum Ns accepted in a primer 0 -numnsaccepted=$value 26 Note Maximum number of unknown bases (N) allowable in any primer. selfany Maximum self complementarity 8.00 -selfany=$value 27 Note The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' ...|| | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' ...|| | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. selfend Maximum 3' self complementarity 3.00 -selfend=$value 28 Note The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example 5' ATGCCCTAGCTTCCGGATG 3' .............||| ||||| ..........3' AAGTCCTACATTTAGCCTAGT 5' or 5' AGGCTATGGGCCTCGCGA 3' ...............|||||| ............3' AGCGCTCCGGGTATCGGA 5' The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5' to 3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment. maxpolyx Maximum polynucleotide repeat 5 -maxpolyx=$value 29 Note The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA. product Product details true productosize Product optimum size 200 -productosize=$value 30 Note The optimum size for the PCR product. 0 indicates that there is no optimum product size. productsizerange Product size range 100-300 -productsizerange=$value 31 Note The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form (x)-(y) where an (x)-(y) pair is a legal range of lengths for the product. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100-150. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100-150 200-250. Primer3 favors ranges to the left side of the parameter string. Primer3 will return legal primers pairs in the first range regardless the value of the objective function for these pairs. Only if there are an insufficient number of primers in the first range will Primer3 return primers in a subsequent range. productotm Product optimum Tm 0.0 -productotm=$value 32 Note The optimum melting temperature for the PCR product. 0 indicates that there is no optimum temperature. productmintm Product minimum Tm -1000000.0 -productmintm=$value 33 Note The minimum allowed melting temperature of the amplicon. Please see the documentation on the maximum melting temperature of the product for details. productmaxtm Product maximum Tm 1000000.0 -productmaxtm=$value 34 Note The maximum allowed melting temperature of the amplicon. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence. A similar formula is used by the prime primer selection program in GCG http://www.gcg.com), which instead uses 675.0/length in the last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms). The formulas here and in Baldino et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to .2 M Na+. Primer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions. primerweights Primer Penalty Weights true maxendstability Maximum 3' end stability 9.0 -maxendstability=$value 35 Note The maximum stability for the five 3' bases of a forward or reverse primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Primer3 uses a completely permissive default value for backward compatibility (which we may change in the next release). Rychlik recommends a maximum value of 9 (Wojciech Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in BA White, Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications', 1993, pp 31-40, Humana Press, Totowa NJ). oligosinput Internal Oligo Input true oligoexcludedregion Internal oligo excluded region -oligoexcludedregion=$value 36 Note Middle oligos may not overlap any region specified by this tag. The associated value must be a space-separated list of (start),(end) pairs, where (start) is the index of the first base of an excluded region, and (end) is the last. Often one would make Target regions excluded regions for internal oligos. oligoinput Internal oligo input sequence (if any) -oligoinput=$value 37 Note The sequence of an internal oligo to check and around which to design forward and reverse primers. Must be a substring of SEQUENCE. oligos Internal Oligo Details true oligoosize Internal oligo optimum size 20 -oligoosize=$value 38 Note Optimum length (in bases) of an internal oligo. Primer3 will attempt to pick primers close to this length. oligominsize Internal oligo minimum size 18 -oligominsize=$value 39 Note Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE. oligomaxsize Internal oligo maximum size 27 -oligomaxsize=$value 40 Note Maximum acceptable length (in bases) of an internal oligo. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which Primer3's melting-temperature is valid. oligootm Internal oligo optimum Tm 60.0 -oligootm=$value 41 Note Optimum melting temperature (Celsius) for an internal oligo. Primer3 will try to pick oligos with melting temperatures that are close to this temperature. The oligo melting temperature formula in Primer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion. oligomintm Internal oligo minimum Tm 57.0 -oligomintm=$value 42 Note Minimum acceptable melting temperature(Celsius) for an internal oligo. oligomaxtm Internal oligo maximum Tm 63.0 -oligomaxtm=$value 43 Note Maximum acceptable melting temperature (Celsius) for an internal oligo. oligoogcpercent Internal oligo optimum GC percent 50.0 -oligoogcpercent=$value 44 Note Intern