#!/usr/bin/perl #BEGIN{foreach (@INC) {s/\/usr\/local\/packages/\/local\/platform/}}; #use lib (@INC,$ENV{"PERL_MOD_DIR"}); #no lib "$ENV{PERL_MOD_DIR}/i686-linux"; #no lib "."; =head1 NAME split_multifasta.pl - split a single FASTA file containing multiple sequences into separate files. =head1 SYNOPSIS USAGE: split_multifasta.pl --input_file=/path/to/some_file.fsa --output_dir=/path/to/somedir [ --output_list=/path/to/somefile.list --output_subdir_size=1000 --output_subdir_prefix=fasta --seqs_per_file=1 --compress_output=1 ] split_multifasta.pl --in snapdmel.aa --output_dir=./ --f=snaa --seqs_per_file=1000 =head1 OPTIONS B<--input_file,-i> The input multi-fasta file to split. B<--output_dir,-o> The directory to which the output files will be written. B<--output_list,-s> Write a list file containing the paths of each of the regular output files. This may be useful for later scripts that can accept a list as input. B<--output_file_prefix,-f> If defined, each file created will have this string prepended to its name. This is ignored unless writing multiple sequences to each output file using the --seqs_per_file option with a value greater than 1, else each file created will just be a number. B<--output_subdir_size,-u> If defined, this script will create numbered subdirectories in the output directory, each containing this many sequences files. Once this limit is reached, another subdirectory is created. B<--output_subdir_prefix,-p> To be used along with --output_subdir_size, this allows more control of the names of the subdirectories created. Rather than just incrementing numbers (like 10), each subdirectory will be named with this prefix (like prefix10). B<--compress_output,-c> Output fasta files will be gzipped when written. B<--debug,-d> Debug level. Use a large number to turn on verbose debugging. B<--log,-l> Log file B<--help,-h> This help message =head1 DESCRIPTION This script is used to split a single FASTA file containing multiple sequences into separate files containing one sequence each. =head1 INPUT The input is defined with --input_file and should be a single fasta file. File extensions are ignored. When creating this multi-entry FASTA file, one should take care to make the first *word* after the > symbol a unique value, as it will be used as the file name for that sequence. For example: >gi53791237 Tragulus javanicus p97bcnt gene for p97Bcnt ACAGGAGAAGAGACTGAAGAGACACGTTCAGGAGAAGAGCAAGAGAAGCCTAAAGAAATGCAAGAAGTTA AACTCACCAAATCACTTGTTGAAGAAGTCAGGTAACATGACATTCACAAACTTCAAAACTAGTTCTTTAA AAAGGAACATCTCTCTTTTAATATGTATGCATTATTAATTTATTTACTCATTGGCGTGGAGGAGGAAATG >gi15387669 Corynebacterium callunae pCC1 plasmid ATGCATGCTAGTGTGGTGAGTATGAGCACACACATTCATGGGCACCGCCGGGGTGCAGGGGGGCTTGCCC CTTGTCCATGCGGGGTGTGGGGCTTGCCCCGCCGATAGAGACCGGCCACCACCATGGCACCCGGTCGCGG GGTGATCGGCCACCACCACCGCCCCCGGCCACTCTCCCCCTGTCTAGGCCATATTTCAGGCCGTCCACTG Whitespace is ignored within the input file. See the OUTPUT section for more on creation of output files. =head1 OUTPUT The name of each output sequence file is pulled from the FASTA header of that sequence. The first *word* after the > symbol will be used as the file name, along with the extension .fsa. The word is defined as all the text after the > symbol up to the first whitespace. If the above example were your input file, two files would be created: gi53791237.fsa gi15387669.fsa Any characters other than a-z A-Z 0-9 . _ - in the ID will be changed into an underscore. This only occurs in the file name; the original FASTA header within the file will be unmodified. You can pass a path to the optional --output_list to create a text file containing the full paths to each of the FASTA files created by this script. Two other optional arguments, --output_subdir_size and --output_subdir_prefix, can be used on input sets that are too large to write out to one directory. This depends on the limitations of your file system, but you usually don't want 100,000 files written in the same directory. If you have an FASTA file containing 95000 sequences, and use the following option: --output_dir=/some/path --output_subdir_size=30000 The following will be created: directory file count --------------------------------- /some/path/1/ 30000 /some/path/2/ 30000 /some/path/3/ 30000 /some/path/4/ 5000 If you choose to create a list file (and you probably want to), it will contain these proper paths. You may not want the subdirectories to simply be numbers, as above, so you can use the --output_subdir_prefix option. For example: --output_dir=/some/path --output_subdir_size=30000 --output_subdir_prefix=fasta The following will be created: directory file count --------------------------------- /some/path/fasta1/ 30000 /some/path/fasta2/ 30000 /some/path/fasta3/ 30000 /some/path/fasta4/ 5000 Finally, you can write multiple sequences to each output file using the --seqs_per_file option, which can be used along with --outupt_subdir_size and --output_subdir_prefix. The main difference to note is that, if you use --seqs_per_file, the fasta file created will no longer be named using values taken from the header, since it will contain multiple headers. Instead, the file will simply be named using sequential numbers starting at 1 (like 1.fsa). For example: --output_dir=/some/path --output_subdir_size=3000 --output_subdir_prefix=fasta --seqs_per_file=10 The following will be created: directory file count --------------------------------- /some/path/fasta1/ 3000 /some/path/fasta2/ 3000 /some/path/fasta3/ 3000 /some/path/fasta4/ 500 =head1 CONTACT Joshua Orvis jorvis@tigr.org =cut use strict; use Getopt::Long; # qw(:config no_ignore_case no_auto_abbrev pass_through); use Pod::Usage; # BEGIN { # use Ergatis::Logger; # } my %options = (); my $results = GetOptions (\%options, 'input_file|i=s', 'output_dir|o=s', 'output_file_prefix|f=s', 'output_list|s=s', 'output_subdir_size|u=s', 'output_subdir_prefix|p=s', 'seqs_per_file|n|e=s', 'compress_output|c=s', 'log|l=s', 'debug=s', 'help|h') || pod2usage(); # my $logfile = $options{'log'} || Ergatis::Logger::get_default_logfilename(); # my $logger = new Ergatis::Logger('LOG_FILE'=>$logfile, # 'LOG_LEVEL'=>$options{'debug'}); # $logger = $logger->get_logger(); my $logfile = $options{'log'} || "log.file"; my $logger = new logger('LOG_FILE'=>$logfile, 'LOG_LEVEL'=>$options{'debug'}); ## display documentation if( $options{'help'} ){ pod2usage( {-exitval => 0, -verbose => 2, -output => \*STDERR} ); } ## make sure everything passed was peachy &check_parameters(\%options); ## open the list file if one was passed my $listfh; if (defined $options{output_list}) { open($listfh, ">$options{output_list}") || $logger->logdie("couldn't create $options{output_list} list file"); } my $first = 1; my $seq = ''; my $header; my $sfh; ## load the sequence file if ($options{'input_file'} =~ /\.(gz|gzip)$/) { open ($sfh, "<:gzip", $options{'input_file'}) || $logger->logdie("can't open sequence file:\n$!"); } else { open ($sfh, "<$options{'input_file'}") || $logger->logdie("can't open sequence file:\n$!"); } my $sub_dir = 1; my $seq_file_count = 0; ## keep track of how many sequences are in the current output file my $seqs_in_file = 0; my $group_filename_prefix = 1; ## holds the output file handle my $ofh; while (<$sfh>) { ## if we find a header line ... if (/^\>(.*)/) { ## write the previous sequence before continuing with this one unless ($first) { &writeSequence(\$header, \$seq); ## reset the sequence $seq = ''; } $first = 0; $header = $1; ## else we've found a sequence line } else { ## skip it if it is just whitespace next if (/^\s*$/); ## record this portion of the sequence $seq .= $_; } } ## don't forget the last sequence &writeSequence(\$header, \$seq); exit; sub check_parameters { my $options = shift; ## make sure input_file and output_dir were passed unless ( $options{input_file} && $options{output_dir} ) { $logger->logdie("You must pass both --input_file and --output_dir"); } ## make sure input_file exists if (! -e $options{input_file} ) { if ( -e "$options{input_file}.gz" ) { $options{input_file} .= '.gz'; } else { $logger->logdie("the input file passed ($options{input_file}) cannot be read or does not exist"); } } ## make sure the output_dir exists if (! -e "$options{output_dir}") { $logger->logdie("the output directory passed could not be read or does not exist"); } ## seqs_per_file, if passed, must be at least one if (defined $options{seqs_per_file} && $options{seqs_per_file} < 1) { $logger->logdie("seq_per_file setting cannot be less than one"); } ## handle some defaults $options{output_subdir_size} = 0 unless ($options{output_subdir_size}); $options{output_subdir_prefix} = '' unless ($options{output_subdir_prefix}); $options{seqs_per_file} = 1 unless ($options{seqs_per_file}); $options{output_file_prefix} = '' unless ($options{output_file_prefix}); } sub writeSequence { my ($header, $seq) = @_; ## the id used to write the output file will be the first thing ## in the header up to the first whitespace. get that. $$header =~ /^(\S+)/ || $logger->logdie( "can't pull out an id on header $$header" ); my $id = $1; ## because it is going to be the filename, we're going to take out the characters that are bad form to use ## legal characters = a-z A-Z 0-9 - . _ $id =~ s/[^a-z0-9\-_.]/_/gi; my $dirpath; ## if we're writing more than one sequence to a file, change the id from ## fasta header to the current group file name if ($options{seqs_per_file} > 1) { $id = $group_filename_prefix; ## did the user ask for a file prefix? if ( $options{output_file_prefix} ) { $id = $options{output_file_prefix} . $id; } } ## the path depends on whether we are using output subdirectories if ($options{output_subdir_size}) { $dirpath = "$options{'output_dir'}/$options{output_subdir_prefix}$sub_dir"; } else { $dirpath = "$options{'output_dir'}"; } ## did the user ask for a file prefix? my $filepath = "$dirpath/$id.fsa"; ## take any // out of the filepath $filepath =~ s|/+|/|g; ## write the sequence $logger->debug("Writing sequence to $filepath") if ($logger->is_debug()); ## open a new output file if we need to ## if we're writing multiple sequences per file, we only open a new ## one when $seqs_in_file = 0 (first sequence) if ($seqs_in_file == 0) { ## if the directory we want to write to doesn't exist yet, create it mkdir($dirpath) unless (-e $dirpath); if ($options{'compress_output'}) { open ($ofh, ">:gzip", $filepath.".gz") || $logger->logdie("can't create '$filepath.gz':\n$!"); } else { open ($ofh, ">$filepath") || $logger->logdie("can't create '$filepath':\n$!"); } $seq_file_count++; ## add the file we just wrote to the list, if we were asked to if (defined $options{output_list}) { print $listfh "$filepath\n"; } } ## if we're doing output subdirs and hit our size limit, increment to the next dir if ($options{output_subdir_size} && $options{output_subdir_size} == $seq_file_count) { $seq_file_count = 0; $sub_dir++; } ## write the sequence print $ofh ">$$header\n$$seq\n"; $seqs_in_file++; ## if we hit the limit of how many we want in each file, set the next file name and ## reset the count of seqs within the file if ($options{seqs_per_file} == $seqs_in_file) { $seqs_in_file = 0; $group_filename_prefix++; } } package logger; sub new { my $packname= shift; my %args= @_; my $self= \%args; bless($self,$packname); return $self; } sub get_logger { my $self= shift; return $self; } sub logdie { my $self= shift; die @_; } sub debug { my $self= shift; warn @_; } sub is_debug { shift->{LOG_LEVEL} || 0; } 1;